Journal of Bacteriology

High Quality Draft Genome Sequences of 28 Enterococcus sp. Isolates.

Publication Date: 2010 Mar 5 PMID: 20207762
Authors: Palmer, K. L. - Carniol, K. - Manson, J. M. - Heiman, D. - Shea, T. - Young, S. - Zeng, Q. - Gevers, D. - Feldgarden, M. - Birren, B. - Gilmore, M. S.
Journal: J Bacteriol

The enterococci are low GC gram-positive bacteria that have emerged as leading causes of hospital acquired infection. They are also commensals of the gastrointestinal tract of healthy humans and most other animals with gastrointestinal flora, and are important for food fermentations. Here we report the availability of draft genome sequences for twenty-eight enterococcal strains of diverse origin, including the species Enterococcus faecalis, E. faecium, E. casseliflavus and E. gallinarum.

post to: CiteULike

Genome Announcement Complete Genome sequence of Enterobacter cloacae subsp. cloacae type strain ATCC 13047.

Publication Date: 2010 Mar 5 PMID: 20207761
Authors: Ren, Y. - Ren, Y. - Zhou, Z. - Guo, X. - Li, Y. - Feng, L. - Wang, L.
Journal: J Bacteriol

Enterobacter cloacae is an important nosocomial pathogen. Here we report the complete genome sequence of E. cloacae ATCC 13047, the type strain of E. cloacae subsp. cloacae. Multiple sets of virulence determinant and heavy-metal resistant genes have been found on the genome. To the best of our knowledge, this is the first complete genome of E. cloacae species.

post to: CiteULike

Regulation of pga operon expression and biofilm formation in Actinobacillus pleuropneumoniae by {sigma}E and H-NS.

Publication Date: 2010 Mar 5 PMID: 20207760
Authors: Bosse, J. T. - Sinha, S. - Li, M. S. - O'Dwyer, C. A. - Nash, J. H. - Rycroft, A. N. - Kroll, J. S. - Langford, P. R.
Journal: J Bacteriol

Clinical isolates of the porcine pathogen Actinobacillus pleuropneumoniae often form adherent colonies on agar plates due to expression of an operon, pgaABCD, encoding a poly-N-acetylglucosamine (PGA) extracellular matrix. The adherent colony phenotype, which correlates with the ability to form a biofilm on the surface of polystyrene plates, is lost following serial passage in broth culture, and repeated passage of the non-adherent variants on solid media does not result in reversion to the adherent colony phenotype. In order to investigate the regulation of PGA expression and biofilm formation in A. pleuropneumoniae, we screened a bank of transposon mutants of the non-adherent serovar 1 strain, S4074(T), and identified mutations in two genes, rseA and hns, which resulted in formation of the adherent colony phenotype. In other bacteria, including the Enterobacteriaceae, H-NS acts as a global gene regulator, and RseA is a negative regulator of the extracytoplasmic stress response sigma factor, sigma(E). Transcription profiling of A. pleuropneumoniae rseA and hns mutants revealed that both sigma(E) and H-NS independently regulate expression of the pga operon. Transcription of the pga operon is initiated from a sigma(E) promoter site in the absence of H-NS, and up-regulation of sigma(E) is sufficient to displace H-NS, allowing transcription to proceed. In A. pleuropneumoniae, H-NS does not act as a global gene regulator, but rather specifically regulates biofilm formation via repression of the pga operon. Positive regulation of the pga operon by sigma(E) indicates that biofilm formation is part of the extracytoplasmic stress response in A. pleuropneumoniae.

post to: CiteULike

Physiological and transcriptional response of Lactobacillus casei ATCC 334 to acid stress.

Publication Date: 2010 Mar 5 PMID: 20207759
Authors: Broadbent, J. R. - Larsen, R. L. - Deibel, V. - Steele, J. L.
Journal: J Bacteriol

This study investigated features of the acid tolerance response (ATR) in Lactobacillus casei ATCC 334. To optimize ATR induction, cells were acid adapted for 10 or 20 min at different pH values (range = pH 3.0-5.0), then acid challenged at pH 2.0. Adaptation over a broad range in pH improved acid tolerance, but highest survival was noted in cells acid adapted for 10 or 20 min at pH 4.5. Analysis of cytoplasmic membrane fatty acids (CMFA) in acid-adapted cells showed they had significantly (P < 0.05) higher total percentages of saturated and cyclopropane FAs than control cells. Specifically, large increases in the percentages for C14:0, C16:1n(9), C16:0, and C:19((11c)) were noted in the CMFAs of acid adapted and acid adapted, acid challenged cells, while C18:1n(9) and C18:1n(11) showed the greatest decrease. Comparison of the transcriptome from control cells (grown at pH 6.0) against that from cells acid adapted for 20 min at pH 4.5 indicated acid adaption invoked a stringent-type response that was accompanied by other functions which likely helped these cells resist acid damage, including malolactic fermentation and intracellular accumulation of His. Validation of microarray data was provided by experiments that showed L. casei survival at pH 2.5 was improved at least 100-fold by chemical induction of the stringent response or by the addition of 30 mM malate or 30 mM histidine to the acid challenge medium. To our knowledge, this is the first report that intracellular histidine accumulation may be involved in acid resistance by bacteria.

post to: CiteULike

Crystal structure of activated CheY1 from Helicobacter pylori.

Publication Date: 2010 Mar 5 PMID: 20207758
Authors: Lam, K. H. - Ling, T. K. - Au, S. W.
Journal: J Bacteriol

Chemotaxis is an important virulence factor for H. pylori colonization and infection. The chemotactic system of H. pylori is marked by the presence of multiple response regulators: CheY1, one CheY-like-containing CheA (CheAY2) and three CheV proteins. Recent studies have demonstrated that these molecules play unique roles in the chemotactic signal transduction mechanisms of H. pylori. Here we report the crystal structures of BeF3(-)-activated CheY1 from H. pylori resolved to 2.4 A. Structural comparison of CheY1 with active site residues of BeF3(-)-bound CheY from E. coli and fluorescence quenching experiments revealed the importance of Thr84 in the phosphotransfer reaction. Complementation assays using various nonchemotactic E. coli mutants and pull-down experiments demonstrated that CheY1 displays differential association with the flagella motor in E. coli. The structural rearrangement of helix 5 and the C-terminal loop in CheY1 provide a different interaction surface for FliM. On the other hand, interaction of the CheA-P2 domain with CheY1, but not with CheY2/CheV proteins, underlines the preferential recognition of CheY1 by CheA in the phosphotransfer reaction. Our results provide the first structural insight into the features of the H. pylori chemotactic system as a model for epsilon proteobacteria.

post to: CiteULike

Advantage of up-regulation of succinate dehydrogenase in Staphylococcus aureus biofilm.

Publication Date: 2010 Mar 5 PMID: 20207757
Authors: Gaupp, R. - Schlag, S. - Liebeke, M. - Lalk, M. - Gotz, F.
Journal: J Bacteriol

Previous studies have demonstrated that various TCA cycle genes, particularly the succinate dehydrogenase genes (sdhCAB), were up-regulated in Staphylococcus aureus biofilm. To better study the role of this enzyme complex, a sdhCAB deletion mutant (Deltasdh) was constructed. Compared to the wild type the mutant was impaired in planktonic growth under aerobic conditions, excreted acetic acid could not be re-used and accumulated continuously, succinate was excreted and found in the culture supernatant, and metabolome analysis with cells grown in chemically defined media revealed reduced uptake/metabolism of some amino acids from the growth medium. Moreover, the mutant was able to counteract the steadily decreasing extracellular pH by increased urease activity. The addition of fumarate to the growth media restored the wt phenotype. The mutant showed a small colony variant (SCV)-like phenotype, a slight increase in resistance to various aminoglycoside antibiotics and decreased pigmentation. The decreased growth under aerobic conditions is due to the interruption of the TCA cycle (indicated by the accumulation of succinate and acetic acid) with the consequence that much less reduction equivalents (NADH and FADH2) can fuel the respiratory chain. The results indicate that the TCA cycle is required for acetate and amino acid catabolism; its up-regulation under biofilm conditions is advantageous under such nutrient and oxygen limited conditions.

post to: CiteULike

Characterization of Klebsiella aerogenes Urease Accessory Protein UreD in Fusion with the Maltose Binding Protein.

Publication Date: 2010 Mar 5 PMID: 20207756
Authors: Carter, E. L. - Hausinger, R. P.
Journal: J Bacteriol

Assembly of the Klebsiella aerogenes urease metallocenter requires four accessory proteins, UreD, UreE, UreF, and UreG, to effectively deliver and incorporate two Ni(2+) ions into the nascent active site of the urease apoprotein (UreABC). Each accessory protein has been purified and characterized with the exception of UreD, due to its insolubility when overproduced in recombinant cells. In this study, a translational fusion was made between the maltose binding protein (MBP) and UreD, with the resulting MBP-UreD found to be soluble in Escherichia coli cell extracts and able to complement a DeltaureD-urease cluster in this host microorganism. MBP-UreD was purified as a large multimer (>670 kDa) that bound approximately 2.5 Ni(2+) (Kd approximately 50 muM) per UreD protomer according to equilibrium dialysis measurements. Zn(2+) directly competes with 10-fold higher affinity ( approximately 4 Zn(27plus;) per protomer, Kd = 5 muM) for the Ni(2+) binding sites. MBP pull-down experiments demonstrated that the UreD domain of MBP-UreD formed in vivo complexes with UreF, UreG, UreF plus UreG, or UreABC when these proteins were overproduced in the same E. coli cells. In addition, a UreABC-(MBP-UreD)-UreFG complex was observed in cells producing all urease components. Comparative in vitro binding experiments with purified proteins demonstrated an approximate 1:1 binding ratio between the UreD domain of MBP-UreD and the UreF domain of the UreEF fusion, only weak or transient interaction between MBP-UreD and UreG, and no binding with UreABC. These studies are the first to describe the properties of purified UreD and they extend our understanding of its binding partners, both in vitro and in the cell.

post to: CiteULike

Phylogeny of Gammaproteobacteria.

Publication Date: 2010 Mar 5 PMID: 20207755
Authors: Williams, K. P. - Gillespie, J. J. - Sobral, B. W. - Nordberg, E. K. - Snyder, E. E. - Shallom, J. M. - Dickerman, A. W.
Journal: J Bacteriol

The phylogeny of the large bacterial class Gammaproteobacteria has been difficult to resolve. Here we apply a telescoping multi-protein approach to the problem for 104 diverse gammaproteobacterial genomes, based on a set of 356 protein families for the whole class, and even larger sets for each of four cohesive subregions of the tree. Although the deepest divergences were resistant to full resolution, some surprising patterns were strongly supported. A representative of the Acidithiobacillales routinely appeared among the outgroup, suggesting that in conflict with rRNA-based phylogenies this order does not belong to Gammaproteobacteria; instead, it (and, independently, Mariprofundus) diverged after the establishment of the Alphaproteobacteria yet before the beta-/gamma-proteobacterial split. None of the orders Alteromonadales, Pseudomonadales, or Oceanospirillales were monophyletic; we obtained strong support for clades that contain some but exclude other members of all three orders. Extreme amino acid bias in the highly A+T-rich genome of Carsonella prevented its reliable placement within Gammaproteobacteria, and high bias caused artifacts that limited the resolution of the relationships of other insect endosymbionts, which appear to have had multiple origins although the unbiased genome of the endosymbiont Sodalis acted as an attractor for them. Instability was observed for the root of the Enterobacteriales, with nearly equal subsets of the protein families favoring one or the other of two alternative root positions; the nematode symbiont Photorhabdus was identified as a disruptor whose omission helped stabilize the Enterobacteriales root.

post to: CiteULike

Complete Genome Sequence of Bifidobacterium animalis subsp. lactis BB-12, a Widely Consumed Probiotic Strain.

Publication Date: 2010 Feb 26 PMID: 20190051
Authors: Garrigues, C. - Johansen, E. - Pedersen, M. B.
Journal: J Bacteriol

Bifidobacterium animalis subsp. lactis BB-12 is a commercially available probiotic strain used throughout the world in a variety of functional foods and dietary supplements. The benefits of BB-12 have been documented in a number of independent clinical trials. Determination of the complete genome sequence reveals a single circular chromosome of 1,942,198 base pairs with 1642 predicted protein coding genes, four rRNA operons and 52 tRNA genes. Knowledge of this sequence will lead to insight into the specific features which give this strain its probiotic properties.

post to: CiteULike

Kinetic Characterization of the WalRKSpn (VicRK) Two-Component System of Streptococcus pneumoniae: Dependence of WalKSpn (VicK) Phosphatase Activity on Its PAS Domain.

Publication Date: 2010 Feb 26 PMID: 20190050
Authors: Gutu, A. D. - Wayne, K. J. - Sham, L. T. - Winkler, M. E.
Journal: J Bacteriol

The WalRK two-component system plays important roles in maintaining cell wall homeostasis and responding to antibiotic stress in low GC gram-positive bacteria. In the major human pathogen, S. pneumoniae, phosphorylated WalRSpn (VicR) response regulator positively controls transcription of genes encoding the essential PcsB division protein and surface virulence factors. WalRSpn is phosphorylated by the WalKSpn (VicK) histidine kinase. Little is known about the signals sensed by WalK histidine kinases. To gain information about WalKSpn signal transduction, we performed a kinetic characterization of the WalRKSpn autophosphorylation, phosphoryltransferase, and phosphatase reactions. We were unable to purify soluble full-length WalKSpn. Consequently, these analyses were performed using two truncated versions of WalKSpn lacking its single transmembrane domain. The longer version (Delta35 amino acids) contained most of the HAMP domain and the PAS, DHp, and CA domains, whereas the shorter version (Delta195 amino acids) contained only the DHp and CA domains. The autophosphorylation kinetic parameters of Delta35 and Delta195 WalKSpn were similar (Km(ATP) approximately 37 muM; kcat approximately 0.10 min(-1)) and typical of those of other histidine kinases. The catalytic efficiency of the two versions of WalKSpn approximately P were also similar in the phosphoryltransfer reaction to full-length WalRSpn. In contrast, absence of the HAMP-PAS domains significantly diminished the phosphatase activity of WalKSpn for WalRSpn approximately P. Deletion and point mutations confirmed that optimal WalKSpn phosphatase activity depended on the PAS domain as well as residues in the DHp domain. In addition, these WalKSpn DHp domain and DeltaPAS mutations led to attenuation of virulence in a murine pneumonia model.

post to: CiteULike

Transcriptome analysis of Pseudomonas syringae identifies new genes, ncRNAs, and antisense activity.

Publication Date: 2010 Feb 26 PMID: 20190049
Authors: Filiatrault, M. J. - Stodghill, P. V. - Bronstein, P. A. - Moll, S. - Lindeberg, M. - Grills, G. - Schweitzer, P. - Wang, W. - Schroth, G. P. - Luo, S. - Khrebtukova, I. - Yang, Y. - Thannhauser, T. - Butcher, B. G. - Cartinhour, S. - Schneider, D. J.
Journal: J Bacteriol

To fully understand how bacteria respond to their environment, it is essential to assess genome-wide transcriptional activity. New high throughput sequencing technologies make it possible to query the transcriptome of an organism in an efficient unbiased manner. We applied a strand-specific method to sequence bacterial transcripts using Illumina's high-throughput sequencing technology. The resulting sequences were used to construct genome-wide transcriptional profiles. Novel bioinformatics analyses were developed and used in combination with proteomics data for the qualitative classification of transcriptional activity in defined regions. As expected, most transcriptional activity was consistent with predictions from the genome annotation. Importantly, we identified and confirmed transcriptional activity in areas of the genome inconsistent with the annotation and in un-annotated regions. Further analyses revealed potential RpoN-dependent promoter sequences upstream of several ncRNAs suggesting a role for these ncRNAs in RpoN-dependent phenotypes. We were also able to validate a number of transcriptional start sites, many of which were consistent with predicted promoter motifs. Overall, our approach provides an efficient way to survey global transcriptional activity in bacteria and enables rapid discovery of specific areas in the genome that merit further investigation.

post to: CiteULike

Functional diversity of four glycoside hydrolase family 3 enzymes from the rumen bacterium, Prevotella bryantii B14.

Publication Date: 2010 Feb 26 PMID: 20190048
Authors: Dodd, D. - Kiyonari, S. - Mackie, R. I. - Cann, I. K.
Journal: J Bacteriol

Prevotella bryantii B14 is a member of the Bacteroidetes phylum and contributes to degradation of hemicellulose in the rumen. The genome of P. bryantii harbors four genes predicted to encode glycoside hydrolase (GH) family 3 enzymes. To evaluate whether these genes encode enzymes with redundant biological functions, each gene was cloned and expressed in Escherichia coli. Biochemical analysis of the recombinant proteins revealed that the enzymes exhibit different substrate specificities. One gene encoded a cellodextrinase (CdxA), and three genes encoded beta-xylosidase enzymes (Xyl3A, Xyl3B, Xyl3C) with different specificities for either para-nitrophenyl linked substrates or substituted xylo-oligosaccharides. To identify the amino acid residues that contribute to catalysis and substrate specificity within this family of enzymes, the roles of conserved residues (R177, K214, H215, M251, and D286) in Xyl3B were probed by site-directed mutagenesis. Each mutation led to a severely decreased catalytic efficiency without change in the overall structure of the mutant enzymes. Through amino acid sequence alignments, an amino acid residue (E115) which when mutated to aspartic acid resulted in a 14-fold decrease in kcat/KM for pNP-beta-D-xylopyranoside (pNPX) with a concurrent 1.1-fold increase in kcat/KM for pNP-beta-D-glucopyranoside (pNPG) was identified. Amino acid residue E115 may, therefore, contribute to discrimination between beta-xylosides and beta-glucosides. Our results demonstrate that each of the four GH 3 enzymes has evolved to perform a specific role in ligno-polysaccharide hydrolysis, and provide insight into the role of active site residues in catalysis and substrate specificity for GH 3 enzymes.

post to: CiteULike

Characterization of Acp, a peptidoglycan hydrolase of Clostridium perfringens with N-acetylglucosaminidase activity, implicated in cell separation and stress-induced autolysis.

Publication Date: 2010 Feb 26 PMID: 20190047
Authors: Camiade, E. - Peltier, J. - Bourgeois, I. - Couture-Tosi, E. - Courtin, P. - Antunes, A. - Chapot-Chartier, M. P. - Dupuy, B. - Pons, J. L.
Journal: J Bacteriol

This work reports the characterization of the first known peptidoglycan hydrolase (Acp) mainly produced during vegetative growth of C. perfringens. Acp has a modular structure with three domains: a signal peptide domain, a N-terminal domain with repeated sequences and a C-terminal catalytic domain. The purified recombinant catalytic domain of Acp displayed a lytic activity on the cell walls of several Gram positive bacterial species. Its hydrolytic specificity was established by analyzing the Bacillus subtilis peptidoglycan digestion products by coupling RP-HPLC and MALDI-TOF MS analysis, which displayed a N-acetylglucosaminidase activity. The study of acp expression showed a constant expression during growth, which suggested an important role of Acp in growth of C. perfringens. Furthermore, cell fractionation and indirect immunofluorescence staining using anti-Acp antibodies revealed that Acp is located at the septal peptidoglycan of vegetative cells during exponential growth phase, indicating a role in cell separation or division of C. perfringens. A knockout acp mutant strain was obtained by using the insertion of mobile Group II intron strategy (ClosTron). The microscopic examination indicated a lack of vegetative cell separation in the acp mutant strain, as well as the wild type strain incubated with anti-Acp antibodies, demonstrating the critical role of Acp in cell separation. The comparative responses of wild type and acp mutant strains to stresses induced by Triton X-100, bile salts and vancomycin revealed an implication of Acp in autolysis induced by these stresses. Overall, Acp appears as a major cell wall N-acetylglucosaminidase implicated in both vegetative growth and stress-induced autolysis.

post to: CiteULike

SprB is the molecular link between Salmonella Pathogenicity Island 1 (SPI1) and SPI4.

Publication Date: 2010 Feb 26 PMID: 20190046
Authors: Saini, S. - Rao, C. V.
Journal: J Bacteriol

Salmonella pathogenicity Island 1 (SPI1) and SPI4 have previously been shown to be jointly regulated. We report that SPI1 and SPI4-encoded gene expression is linked through a transcriptional activator, SprB, encoded within SPI1 and regulated by HilA. SprB directly activates SPI4-encoded gene expression and weakly represses SPI1-encoded gene expression through HilD.

post to: CiteULike

Utilization of Lactose and Galactose by Streptococcus mutans: Transport, Toxicity and Carbon Catabolite Repression.

Publication Date: 2010 Feb 26 PMID: 20190045
Authors: Zeng, L. - Das, S. - Burne, R. A.
Journal: J Bacteriol

Abundant in milk and other dairy products, lactose is considered to have an important role in oral microbial ecology and can contribute to caries development in both adults and young children. To better understand the metabolism of lactose and galactose by Streptococcus mutans, the major etiological agent of human tooth decay, a genetic analysis of the tagatose-6-phosphate (lac) and Leloir (gal) pathways was performed in strain UA159. Deletion of each gene in the lac operon caused various alterations in expression of a PlacA-cat promoter fusion and defects in growth on either lactose (lacA, B, F, E, G), galactose (lacA, B, D, G) or both sugars (lacA, B, G). Failure to grow in the presence of galactose or lactose by certain lac mutants appeared to arise from the accumulation of intermediates of galactose metabolism, particularly galatose-6-phosphate (Gal-6-P). The glucose- and lactose-PTS permeases, EII(Man) and EII(Lac), respectively, were shown to be the only effective transporters of galactose in S. mutans. Furthermore, disruption of manL, encoding EIIAB(Man), led to increased resistance to glucose-mediated CCR when lactose was used to induce the lac operon, but resulted in reduced lac gene expression in cells growing on galactose. Collectively, the results reveal a remarkably high degree of complexity in the regulation of lactose/galactose catabolism.

post to: CiteULike

Purification and Characterization of Folate Catabolic Enzyme p-Aminobenzoyl-glutamate Hydrolase from Escherichia coli.

Publication Date: 2010 Feb 26 PMID: 20190044
Authors: Green, J. M. - Hollandsworth, R. - Pitstick, L. - Carter, E. L.
Journal: J Bacteriol

The abg locus of the Escherichia coli (E. coli) chromosome includes three genes encoding proteins (AbgA, AbgB, and AbgT) that enable uptake and utilization of the folate breakdown product, p-aminobenzoyl glutamate (PABA-GLU). We report on the purification and characterization of the p-aminobenzoyl-glutamate hydrolase (PGH) holoenzyme encoded by abgA and abgB. One-step purification was accomplished using a plasmid encoding abgAB with a hexa-histidine tag on the carboxyl terminus of AbgB and subsequent metal affinity chromatography (MAC). Analysis by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS PAGE) revealed two subunits ( approximately 53 kDa and approximately 47 kDa proteins, respectively) of the expected masses of AbgB and AbgA; N -terminal sequencing confirmed the subunit identification and amino acid analysis yielded a 1:1 ratio of the subunits. Size exclusion chromatography coupled with light scattering analysis of purified PGH revealed a predominant molecular mass of 206 kDa, and a minor component of 400-500 kDa. Both peaks contained PGH activity, and SDS PAGE revealed that fractions containing activity were composed of both AbgA and AbgB. MAC purified PGH was highly stimulated by manganese chloride. Kinetic analysis of MAC purified PGH revealed a Km value for PABA-GLU of 60 +/- 0.08 muM and a specific activity of 63,300 +/- 600 nmoles min(-1) mg (-1). Folic acid and a variety of dipeptides served as poor substrates of PGH. This locus of the E. coli chromosome may encode for a portion of a folate catabolism pathway.

post to: CiteULike

A novel sialic acid utilisation and uptake system in the periodontal pathogen Tannerella forsythia.

Publication Date: 2010 Feb 26 PMID: 20190043
Authors: Roy, S. - Douglas, C. I. - Stafford, G. P.
Journal: J Bacteriol

Tannerella forsythia is a key contributor to periodontitis but little is known of its virulence mechanisms. In this study we have investigated the role of sialic acid in biofilm growth of this periodontal pathogen. Our data show that biofilm growth of T. forsythia is stimulated by sialic acid, glycolyl-sialic acid and sialyllactose: all three being common sugar moieties on a range of important host glycoproteins. We have also established that growth on siallyllactose is dependent on the sialidase of T. forsythia since the sialidase inhibitor oseltamivir suppresses growth on sialyllactose. The genome of T. forsythia contains a sialic acid utilisation locus, which also encodes a putative inner membrane sialic acid permease (nanT) and we have shown this is functional when expressed in E.coli. This genomic locus also contains a putatively novel TonB-dependent outer membrane sialic acid transport system (TF0033-34). In complementation studies using an E.coli strain devoid of its outer membrane sialic acid transporters, the cloning and expression of the TF0033-34 genes conferred an E.coli nanRnanCompR strain with the ability to utilise sialic acid as sole carbon and energy source. We have thus identified a novel sialic acid uptake system that couples an inner membrane permease with a TonB-dependent outer membrane transporter and propose to rename these novel sialic acid uptake genes nanO and nanU respectively. Taken together these data indicate that sialic acid is a key growth factor for this little characterised oral pathogen that may be key to its physiology in vivo.

post to: CiteULike

A DNA-binding peroxiredoxin of Coxiella burnetii is involved in countering oxidative stress during exponential-phase growth.

Publication Date: 2010 Feb 19 PMID: 20173000
Authors: Hicks, L. D. - Raghavan, R. - Battisti, J. M. - Minnick, M. F.
Journal: J Bacteriol

Coxiella burnetii is a gram-negative, obligate intracellular bacterial pathogen that resides within the harsh, acidic confines of a lysosome-like compartment of the host cell, termed a parasitophorous vacuole. In this study, we characterized a thiol-specific peroxidase of C. burnetii that belongs to the atypical 2-cysteine subfamily of peroxiredoxins, commonly referred to as bacterioferritin comigratory proteins (BCPs). Coxiella BCP was initially identified as a potential DNA-binding protein by two-dimensional southwestern (SW) blots of the pathogen's proteome, probed with biotinylated C. burnetii genomic DNA. Identity of the DNA-binding protein as BCP (Cbu_0963) was established by MALDI-TOF/TOF mass spectrometry (MS). Recombinant Coxiella BCP (rBCP) was generated, and its DNA binding was demonstrated by two independent methods, including SW blotting and electrophoretic mobility shift assays (EMSAs). rBCP also demonstrated peroxidase activity in vitro that required thioredoxin/thioredoxin reductase. Both DNA-binding and peroxidase activities of rBCP were lost upon heat denaturation (100 degrees C, 10 min). Functional expression of Coxiella bcp was demonstrated by trans-complementation of an E. coli bcp mutant; as evidenced by the strain's ability to grow in an oxidative-stress growth medium containing tert-butyl hydroperoxide to levels that were indistinguishable from, or significantly greater than, its wild-type parental strain, and significantly greater than bcp mutant (p < 0.05). rBCP was also found to protect supercoiled plasmid DNA from oxidative damage (i.e., nicking) in vitro. Maximal expression of the bcp gene coincided with the pathogen's early exponential-growth phase (2-3d) in a synchronized infection of an epithelial (Vero) host cell line. Taken as a whole, the results show that Coxiella BCP binds DNA and likely serves to detoxify endogenous hydroperoxide byproducts of Coxiella's metabolism during intracellular replication.

post to: CiteULike

The genomic content of Neisseriae Species.

Publication Date: 2010 Feb 19 PMID: 20172999
Authors: Tobiason, D. M. - Seifert, H. S.
Journal: J Bacteriol

The physical properties of most bacterial genomes are largely unexplored. We have previously demonstrated that the strict human pathogen Neisseria gonorrhoeae is polyploid carrying an average of three chromosome copies per cell and only maintaining one pair of replication forks per chromosome (Tobiason and Seifert, PLos Biol, 2006). We are following up this initial report to test several predictions of the polyploidy model of gonococcal chromosome organization. We demonstrate that the N. gonorrhoeae chromosomes exist solely as monomers and not covalently linked dimers, and in agreement with the monomer status we show that distinct nucleoid regions can be detected by electron microscopy. Two different approaches to isolate heterozygous N. gonorrhoeae resulted in the formation of merodiploids showing that even with more than one chromosome copy, these bacteria are genetically haploid. We show that the closely related bacterium N. meningitidis is also polyploid, while the commensal organism N. lactamica maintains chromosomes in single copy. We conclude that the pathogenic Neisseria are homozygous diploids.

post to: CiteULike

In the Staphylococcus aureus two component system sae, the response regulator SaeR binds to a direct repeat sequence and the DNA binding requires phosphorylation by the sensor kinase SaeS.

Publication Date: 2010 Feb 19 PMID: 20172998
Authors: Sun, F. - Li, C. - Jeong, D. - Sohn, C. - He, C. - Bae, T.
Journal: J Bacteriol

Staphylococcus aureus uses the SaeRS two component system to control expression of many virulence factors such as alpha-hemolysin and coagulase; however, the molecular mechanism of this signaling has not yet been elucidated. Here, using the P1 promoter of the sae operon as a model target DNA, we demonstrated that the unphosphorylated response regulator SaeR does not bind to the P1 promoter DNA, while its C-terminal DNA binding domain alone does. The DNA binding activity of the full length SaeR could be restored by sensor kinase SaeS-induced phosphorylation. The phosphorylated SaeR is more resistant to digestion by trypsin, suggesting conformational changes. DNase I footprinting assays revealed that the SaeR protection region in P1 promoter contains a direct repeat sequence GTTAAN6GTTAA (N= any nucleotide). This sequence is critical to the binding of the phosphorylated SaeR. Mutational changes in the repeat sequence greatly reduced both the in vitro binding of SaeR and the in vivo function of the P1 promoter. From these results, we concluded that SaeR recognizes the direct repeat sequence as a binding site and that the binding requires phosphorylation by SaeS.

post to: CiteULike

The interaction of an essential E. coli GTPase, Der with 50S ribosome via the KH-like domain.

Publication Date: 2010 Feb 19 PMID: 20172997
Authors: Hwang, J. - Inouye, M.
Journal: J Bacteriol

An essential E. coli tandem GTPase Der has been implicated in 50S subunit biogenesis. The rrmJ gene encodes a methyltransferase that modifies U2552 residue of 23S rRNA, and its deletion causes a severe growth defect. Peculiarly, overexpression of Der suppresses growth impairment. In this study, using an rrmJ-deletion strain, we demonstrate that two GTPase domains of Der regulate its association with 50S subunit via the KH-like domain. We also identified critical region of Der for its specific interaction with 50S subunit.

post to: CiteULike

Spontaneous excision of the Salmonella enterica serovar Enteritidis-specific defective prophage-like element {Phi}SE14.

Publication Date: 2010 Feb 19 PMID: 20172996
Authors: Santiviago, C. A. - Blondel, C. J. - Quezada, C. P. - Silva, C. A. - Tobar, P. M. - Porwollik, S. - McClelland, M. - Andrews-Polymenis, H. L. - Toro, C. S. - Zaldivar, M. - Contreras, I.
Journal: J Bacteriol

Salmonella enterica serovar Enteritidis (S. Enteritidis) has emerged as a major health problem worldwide in the last few decades. DNA loci unique to S. Enteritidis can provide markers for detection of this pathogen, and may reveal pathogenic mechanisms restricted to this serovar. An in silico comparison of 16 Salmonella genomic sequences revealed the presence of a approximately 12.5-kb genomic island (GEI) specific to the sequenced S. Enteritidis strain NCTC13349. The GEI is inserted at the 5' end of gene ydaO (SEN1377), is flanked by 308-bp imperfect direct repeats (attL and attR) and includes 21 open reading frames (ORFs) (SEN1378 to SEN1398), encoding primarily phage-related proteins. Accordingly, this GEI has been annotated as the defective prophage SE14 in the genome of strain NCTC13349. The genetic structure and location of PhiSE14 is conserved in 99 out of 103 wild-type strains of S. Enteritidis studied here, including reference strains NCTC13349 and LK5. Notably, an extrachromosomal circular form of PhiSE14 was detected in every strain encoding this island. The presence of attP sites were confirmed in the circular forms detected in NCTC13349 and LK5. In addition, we observed spontaneous loss of a tetRA-tagged version of PhiSE14 leaving an empty attB site in the genome of strain NCTC13349. Collectively, these results demonstrate that PhiSE14 is an unstable genetic element that undergoes spontaneous excision under standard growth conditions. An internal fragment of PhiSE14 designated as Sdf I has been used as a serovar-specific genetic marker in PCR-based detection systems, and to quantify S. Enteritidis in experimental infections. The instability of this region may require a re-assessment of its suitability for such applications.

post to: CiteULike

The non-mevalonate pathway of isoprenoid biosynthesis in Mycobacterium tuberculosis is essential and transcriptionally-regulated by Dxs.

Publication Date: 2010 Feb 19 PMID: 20172995
Authors: Brown, A. C. - Eberl, M. - Crick, D. C. - Jomaa, H. - Parish, T.
Journal: J Bacteriol

Mycobacterium tuberculosis synthesises isoprenoids via the non-mevalonate or DOXP pathway. Previous work demonstrated that three enzymes in the pathway (Dxr, IspD and IspF) are all required for growth in vitro. Here, we demonstrate the essentiality of the key genes dxs1 and gcpE, confirming that the pathway is of central importance and that the second homolog of the synthase (dxs2) cannot compensate for the loss of dxs1. We looked at the effect of over expression of Dxr, Dxs1, Dxs2 and GcpE on viability and growth in M. tuberculosis. Over-expression of dxs1 or dxs2 was inhibitory to growth, whereas over-expression of dxr or gcpE was not. Toxicity is likely to be, at least partially, due to depletion of pyruvate from the cells. Over-expression of dxs1 or gcpE resulted in increased flux through the pathway as measured by accumulation of the metabolite 4-hydroxy-3-methyl-but-2-enyl pyrophosphate (HMB-PP). We identified the functional translational start site and promoter region for dxr and demonstrated that it is expressed as part of a polycistronic mRNA with gcpE and two other genes. Increased expression of this operon was seen in cells over-expressing Dxs1, indicating that transcriptional control is effected by the first enzyme of the pathway via an unknown regulator.

post to: CiteULike

Biochemical dissection of the ATPase TraB, the VirB4 homologue of the E. coli pKM101 conjugation machinery.

Publication Date: 2010 Feb 19 PMID: 20172994
Authors: Durand, E. - Oomen, C. - Waksman, G.
Journal: J Bacteriol

Type IV secretion (T4S) systems are involved in several secretion processes including secretion of virulence factors such as toxins or transforming molecules or bacterial conjugation whereby two mating bacteria exchange genetic material. T4S systems are generally composed of 12 protein components, three of which, termed VirB4, VirB11 and VirD4, are ATPases. VirB4 is the largest protein of the T4S system, is known to play a central role and interacts with many other T4S system proteins. In this study, we have biochemically characterized the protein TraB, a VirB4 homologue from the pKM101 conjugation T4S system. We demonstrated that TraB is a modular protein, composed of two domains, both able to bind DNA in a non sequence-specific manner. Surprisingly, both TraB N- and C-terminal domains can bind ATP, revealing a new degenerated nucleotide-binding site in the TraB N-terminal domain. TraB purified from the membrane forms stable dimers and is unable to hydrolyze ATP, while, when purified from the soluble fraction, TraB can form hexamers capable of hydrolyzing ATP. Remarkably, both the N- and C-terminal domains display ATP-hydrolyzing activity. These properties define a new class of VirB4 proteins.

post to: CiteULike

The Abi proteins and their involvement in bacteriocin self-immunity.

Publication Date: 2010 Feb 12 PMID: 20154137
Authors: Kjos, M. - Snipen, L. - Salehian, Z. - Nes, I. F. - Diep, D. B.
Journal: J Bacteriol

The Abi protein family consists of putative membrane-bound metalloproteases. While they are involved in membrane anchoring of proteins in eukaryotes, little is known about their function in prokaryotes. In some known bacteriocin loci, Abi genes have been found downstream of bacteriocin structural genes (e. g. pln locus from Lactobacillus plantarum and sag locus from Streptococcus pyogenes), where they probably are involved in self-immunity. By modifying the profile hidden Markov model used to select Abi proteins in the protein family database Pfam, we show that this family is larger than presently recognized. Using bacteriocin-associated Abi genes as a means to search for novel bacteriocins in sequenced genomes, seven new bacteriocin-like loci in Gram positive bacteria were identified. One such locus from Lactobacillus sakei 23K was selected for further experimental study and it was confirmed that the bacteriocin-like genes (sak23Kalphabeta) exhibited antimicrobial activity when expressed in a heterologous host and that the associated Abi gene (sak23Ki) conferred immunity against the cognate bacteriocin. Similar investigation of the Abi gene plnI and the Abi-like gene plnL from L. plantarum also confirmed their involvement in immunity to their cognate bacteriocins (PlnEF and PlnJK). Interestingly, the immunity genes from these three systems conferred a high degree of cross-immunity against each other's bacteriocins, suggesting the recognition of a common receptor. Site-directed mutagenesis demonstrated that the conserved motifs constituting the putative proteolytic active site of the Abi proteins are essential for the immunity function of Sak23Ki, and to our knowledge, this represents a new concept in self-immunity.

post to: CiteULike

The second extracellular loop of pore-forming subunits of ATP-binding cassette transporters for basic amino acids plays a crucial role in interaction with the cognate solute binding protein(s).

Publication Date: 2010 Feb 12 PMID: 20154136
Authors: Eckey, V. - Weidlich, D. - Landmesser, H. - Bergmann, U. - Schneider, E.
Journal: J Bacteriol

In the thermophile Geobacillus stearothermophilus the uptake of basic amino acids is mediated by an ABC transporter composed of the substrate binding protein (receptor), ArtJ, and a homodimer each of the pore-forming subunit, ArtM, and the nucleotide-binding subunit, ArtP. We have recently identified two putative binding sites in ArtJ that might interact with the Art(MP)2 complex thereby initiating the transport cycle (A. Vahedi-Faridi et al., J. Mol. Biol. 375, 448-459, 2008). Here, we have investigated the contribution of charged amino acid residues in the second extracellular loop of ArtM in contacting ArtJ. Our results demonstrate a crucial role of residues K177, R185, and E188, respectively, since mutations to oppositely charged amino acids or glutamine led to a complete loss in ArtJ-stimulated ATPase activity of the complex variants in proteoliposomes. The defects could not be suppressed by ArtJ variants carrying mutations in site I (K39E, K152E) or II (E163K, D170K) suggesting a more complex interplay than by a single salt bridge. These findings were supported by cross-linking demonstrating physical proximity between ArtJ(N166C) and ArtM(E182C). The importance of positively charged residues for receptor-transporter interaction was underscored by mutational analysis of the closely related transporter HisJ/LAO-HisQMP2 of Salmonella enterica serovar Typhimurium. While transporter variants with mutated positively charged residues in HisQ displayed residual ATPase activities, corresponding mutants of HisM could no longer be stimulated by HisJ/LAO. Interestingly, the ATPase activity of variant HisQM(K187E)P2 was inhibited by L-and D-histidine in detergent, suggesting a role of the residue in preventing free histidine from getting access to the substrate binding site within HisQM.

post to: CiteULike

Strains of the East Asian (W/Beijing) Lineage of Mycobacterium tuberculosis are natural mutants in the DosS/DosT-DosR two-component regulatory system.

Publication Date: 2010 Feb 12 PMID: 20154135
Authors: Fallow, A. - Domenech, P. - Reed, M. B.
Journal: J Bacteriol

As part of our ongoing efforts to uncover the phenotypic consequences of genetic variability amongst clinical Mycobacterium tuberculosis isolates, we have previously reported that isolates of the "East-Asian" or "W/Beijing" lineage constitutively over-express the coordinately regulated transcriptional program known as the "DosR regulon" under standard in vitro conditions. This phenotype distinguishes the W/Beijing lineage from all other M. tuberculosis lineages that normally only induce expression of this regulon once exposed to low oxygen or nitric oxide - both of which result in inhibition of bacterial respiration and replication. Transcription of the DosR regulon is controlled through a two-component regulatory system comprising the transcription factor, DosR, and two possible cognate histidine sensor kinases, DosS or DosT. Through sequence analysis of a carefully selected set of isolates representing each of the major M. tuberculosis lineages, we describe herein a naturally occurring frameshift mutation in the gene encoding the DosT sensor kinase for isolates of the most recently evolved W/Beijing sub-lineages. Intriguingly, the occurrence of the frameshift mutation correlates precisely with the appearance of the constitutive DosR regulon phenotype displayed by these same "modern" W/Beijing strains. However, complementation studies have revealed that the mutation in dosT alone is not directly responsible for the constitutive DosR regulon phenotype. Our data serve to highlight the evolutionary pressure that exists amongst distinct M. tuberculosis lineages to maintain tight control over DosR regulon expression.

post to: CiteULike

Polymyxin B resistance in El Tor Vibrio cholerae requires lipid acylation catalyzed by MsbB.

Publication Date: 2010 Feb 12 PMID: 20154134
Authors: Matson, J. S. - Yoo, H. J. - Hakansson, K. - Dirita, V. J.
Journal: J Bacteriol

Antimicrobial peptides are critical for innate anti-bacterial defense. Both Gram-negative and Gram-positive microbes have mechanisms to alter their surfaces and resist killing by antimicrobial peptides. In Vibrio cholerae, two natural epidemic biotypes, classical and El Tor, exhibit distinct phenotypes with respect to sensitivity to the peptide antibiotic polymyxin B: classical strains are sensitive and El Tor strains are relatively resistant. We carried out mutant screens in both biotypes, aiming to identify classical V. cholerae mutants resistant to polymyxin B and El Tor V. cholerae mutants sensitive to polymyxin B. Insertions in a gene annotated as msbB (a predicted lipid A secondary acyltransferase) answered both screens, implicating its activity in antimicrobial peptide resistance of V. cholerae. Analysis of a defined mutation in the El Tor biotype demonstrated that msbB is required for resistance to all antimicrobial peptides tested. Mutation of msbB in a classical strain resulted in reduced resistance to several antimicrobial peptides, but no significant change in resistance to polymyxin B. msbB mutants of both biotypes showed decreased colonization of infant mice, with a more pronounced defect observed for the El Tor mutant. Mass spectrometry analysis showed that lipid A of the msbB mutant for both biotypes was under-acetylated compared to lipid A of the wild type isolates, confirming that MsbB is a functional acyltransferase in V. cholerae.

post to: CiteULike

The role of FlgT in anchoring the flagellum of Vibrio cholerae.

Publication Date: 2010 Feb 12 PMID: 20154133
Authors: Martinez, R. M. - Jude, B. A. - Kirn, T. J. - Skorupski, K. - Taylor, R. K.
Journal: J Bacteriol

Flagellar motility has long been regarded as an important virulence factor. In Vibrio cholerae, the single polar flagellum is essential for motility as well as for proper attachment and colonization. In this study, we demonstrate that the novel flagellar protein FlgT is involved in anchoring the flagellum to the V. cholerae cell. A screen for novel colonization factors using TnphoA mutagenesis identified flgT. An in-frame deletion of flgT established that FlgT is required for attachment, colonization and motility. Transmission electron microscopy revealed that while the flgT mutant is capable of assembling a phenotypically normal flagellum, the flgT population is mostly aflagellate compared to WT. Further analyses indicate that the flagellum of the flgT mutant is released into the culture supernatant from the cell upon completion of assembly. Additionally, hook basal body complexes appear to be released along with the filament. These results indicate that FlgT functions to stabilize the flagellar apparatus at the pole of the cell.

post to: CiteULike

Protecting from antimicrobial effectors in the phagosome allows SodCII to contribute to virulence in Salmonella enterica serovar Typhimurium.

Publication Date: 2010 Feb 12 PMID: 20154132
Authors: Kim, B. - Richards, S. M. - Gunn, J. S. - Slauch, J. M.
Journal: J Bacteriol

Salmonella enterica serovar Typhimurium replicates in macrophages where it is subjected to antimicrobial substances, including superoxide, antimicrobial peptides, and proteases. The bacterium produces two periplasmic superoxide dismutases, SodCI and SodCII. Although both are expressed during infection, only SodCI contributes to virulence in the mouse by combating phagocytic superoxide. The differential contribution to virulence is at least partially due to inherent differences in the SodCI and SodCII proteins that are independent of enzymatic activity. SodCII is protease-sensitive and, like other periplasmic proteins, is released by osmotic shock. In contrast, SodCI is protease-resistant and is retained within the periplasm after osmotic shock, a phenomenon that we term tethering. We hypothesize that in the macrophage, antimicrobial peptides transiently disrupt the outer membrane. SodCII is released and/or phagocytic proteases gain access to the periplasm and SodCII is degraded. SodCI is both tethered within the periplasm and is protease-resistant, thereby remaining to combat superoxide. Here we test aspects of this model. SodCII was released by antimicrobial peptide polymyxin B or mouse macrophage antimicrobial peptide (CRAMP), while SodCI remained tethered within the periplasm. A Salmonella pmrA-constitutive mutant no longer released SodCII in vitro. Moreover, in the pmrA-constitutive background, SodCII could contribute to survival of Salmonella during infection. SodCII also provided a virulence benefit in mice genetically defective in production of CRAMP. Thus, consistent with our model, protecting the outer membrane from antimicrobial peptides allows SodCII to contribute to virulence in vivo. These data also suggest direct in vivo cooperative interactions between macrophage antimicrobial effectors.

post to: CiteULike

Heterochronic phosphorelay gene expression as a source of heterogeneity in Bacillus subtilis spore formation.

Publication Date: 2010 Feb 12 PMID: 20154131
Authors: de Jong, I. G. - Veening, J. W. - Kuipers, O. P.
Journal: J Bacteriol

In response to limiting nutrient sources and cell density signals, Bacillus subtilis can differentiate and form highly resistant endospores. Initiation of spore development is governed by the master regulator Spo0A, which is activated by phosphorylation via a multi-component phosphorelay. Interestingly, only part of a clonal population will enter this developmental pathway, a phenomenon known as sporulation bistability or sporulation heterogeneity. How sporulation heterogeneity is established is largely unknown. To investigate the origins of sporulation heterogeneity, we constructed promoter-GFP fusions to the main phosphorelay genes and perturbed their expression levels. Using time-lapse fluorescence microscopy and flow cytometry, we show that expression of the phosphorelay genes is distributed in a unimodal manner. However, single cell trajectories reveal that phosphorelay gene expression is highly dynamic or 'heterochronic' between individual cells and that stochasticity of phosphorelay gene transcription might be an important regulatory mechanism for sporulation heterogeneity. Furthermore, we show that artificial induction or depletion of the phosphorelay phosphate flow results in loss of sporulation heterogeneity. Our data suggest that sporulation heterogeneity originates from highly dynamic and variable gene activity of the phosphorelay components, resulting in large cell-to-cell variability with regard to phosphate input into the system. These transcriptional and post-translational differences in phosphorelay activity appear to be sufficient to generate a heterogeneous sporulation signal without the need of the positive feedback loop established by the sigma factor SigH.

post to: CiteULike

Central role of early colonizer Veillonella sp. in establishing multispecies biofilm communities with initial, middle and late colonizers of enamel.

Publication Date: 2010 Feb 12 PMID: 20154130
Authors: Periasamy, S. - Kolenbrander, P. E.
Journal: J Bacteriol

Human dental biofilm communities comprise several species, which can interact cooperatively or competitively. Bacterial interactions influence biofilm formation, metabolic changes, and physiological function of the community. Lactic acid, a common metabolite of oral bacteria, was measured in the flow cell effluent of one-, two- and three-species communities growing on saliva as the sole nutritional source. We investigated single- and multi-species colonization by using known initial, early, middle and late colonizers of enamel. Fluorescent antibody staining and image analysis were used to quantify the biomass in saliva-fed flow cells. Of six species tested, only initial colonizer Actinomyces oris exhibited significant growth. Initial colonizer Streptococcus oralis produced lactic acid but showed no significant growth. Early colonizer Veillonella sp. utilized lactic acid in two- and three-species biofilm communities. The biovolumes of all two-species biofilms increased when Veillonella sp. was present as one of the partners indicating that this early colonizer promotes mutualistic community development. All three-species combinations exhibited enhanced growth except one: A. oris, Veillonella sp. and middle colonizer Porphyromonas gingivalis, indicating specificity among three-species communities. Further specificity was seen when Fusobacterium nucleatum (middle colonizer), Aggregatibacter actinomycetemcomitans (late colonizer) and P. gingivalis did not grow with S. oralis in two-species biofilms, but inclusion of Veillonella sp. resulted in growth of all three-species combinations. We propose that commensal veillonellae use lactic acid for growth in saliva and that they communicate metabolically with initial, early, middle and late colonizers to establish multispecies communities on enamel.

post to: CiteULike

Increase in Rhamnolipid Synthesis Under Iron-Limiting Conditions Influences Surface Motility and Biofilm Formation in Pseudomonas aeruginosa.

Publication Date: 2010 Feb 12 PMID: 20154129
Authors: Glick, R. - Gilmour, C. - Tremblay, J. - Satanower, S. - Avidan, O. - Deziel, E. - Greenberg, E. P. - Poole, K. - Banin, E.
Journal: J Bacteriol

Iron is an essential element for life but also serves as an environmental signal for biofilm development in the opportunistic human pathogen Pseudomonas aeruginosa. Under iron-limiting conditions P. aeruginosa displays enhanced twitching motility and forms flat unstructured biofilms. In this study we present evidence suggesting that iron-regulated production of the biosurfactant rhamnolipid is important to facilitate the flat unstructured biofilm phenotype. We show that under iron limitation the timing of rhamnolipid expression is shifted to the initial stages of biofilm formation (vs. later in biofilm development under iron-replete conditions) and results in increased bacterial surface motility. In support, a rhlAB mutant defective in biosurfactant production showed lower surface motility under iron-restricted conditions and developed structured biofilms similar to those developed by the wild type under iron-replete conditions. These results highlight the importance of biosurfactant production in determining the mature structure of P. aeruginosa biofilms under iron-limiting conditions.

post to: CiteULike

Dual control of Sinorhizobium meliloti RpoE2 sigma factor activity by two PhyR-type two-component response regulators.

Publication Date: 2010 Feb 12 PMID: 20154128
Authors: Bastiat, B. - Sauviac, L. - Bruand, C.
Journal: J Bacteriol

RpoE2 is an extracytoplasmic function (ECF) sigma factor involved in the general stress response of Sinorhizobium meliloti, the nitrogen-fixing symbiont of the legume plant alfalfa. RpoE2 orthologues are widely found among alpha-proteobacteria, where they play various roles in stress resistance and/or host colonization. In this paper, we report a genetic and biochemical investigation of the mechanisms of signal transduction leading to S. meliloti RpoE2 activation in response to stress. We showed that RpoE2 activity is negatively controlled by two paralogous anti-sigma factors, RsiA1 (SMc01505) and RsiA2 (SMc04884), and that RpoE2 activation by stress requires two redundant paralogous PhyR-type response regulators, RsiB1 (SMc01504) and RsiB2 (SMc00794). RsiB1 and RsiB2 do not act at the level of rpoE2 transcription but instead interact with the anti-sigma factors, and we therefore propose that they act as anti-anti-sigma factors to relieve RpoE2 inhibition in response to stress. This model closely resembles a recently proposed model of activation of RpoE2-like sigma factors in Methylobacterium extorquens and Bradyrhizobium japonicum, but the existence of two pairs of anti- and anti-anti-sigma factors in S. meliloti adds an unexpected level of complexity, which may allow the regulatory system to integrate multiple stimuli.

post to: CiteULike

Cell surface xylanases of the glycoside hydrolase family 10 are essential for xylan utilization by Paenibacillus sp. W-61 as a generator of xylo-oligosaccharide inducers for the xylanase genes.

Publication Date: 2010 Feb 12 PMID: 20154127
Authors: Fukuda, M. - Watanabe, S. - Yoshida, S. - Itoh, H. - Itoh, Y. - Kamio, Y. - Kaneko, J.
Journal: J Bacteriol

Paenibacillus sp. W-61 is capable of utilizing water-insoluble xylan for carbon and energy sources, and has three xylanase genes, xyn1, xyn3 and xyn5. Xyn1, Xyn3 and Xyn5 are extracellular enzymes of the glycoside hydrolase (GH) families 11, 30 and 10, respectively. Xyn5 contains several domains including those of carbohydrate-binding modules (CBMs) similar to a surface-layer homologous (SLH) protein. This study focused on the role of Xyn5, localized on the cell surface, in water-insoluble xylan utilization. Electron microscopy using immunogold staining revealed Xyn5 clusters over the entire cell surface. Xyn5 was bound to cell wall fractions through its SLH domain. A Deltaxyn5 mutant grew poorly and produced minimal amounts of Xyn1 and Xyn3 on water-insoluble xylan. A Xyn5 mutant lacking the SLH domain grew poorly, secreting Xyn5DeltaSLH into the medium, producing minimal Xyn1 and Xyn3 on water-insoluble xylan. A mutant with intact xyn5 produced Xyn5 on the cell surface, grew normally and actively synthesized Xyn1 and Xyn3 on water-insoluble xylan. Quantitative RT-PCR showed that xylobiose, generated from water-insoluble xylan decomposition by Xyn5, is the most active inducer for xyn1 and xyn3. Luciferase assays using a Xyn5-luciferase fusion protein suggested that xylotriose is the best inducer for xyn5. The cell-surface Xyn5 appears to play two essential roles in water-insoluble xylan utilization: (1) generation of the xylo-oligosaccharide inducers of all the xyn genes from water-insoluble xylan; (2) attachment of the cells to the substrate so that the generated inducers can be immediately taken up by cells to activate expression of the xyn system.

post to: CiteULike

Organisation of the electron transfer chain to oxygen in the obligate human pathogen, Neisseria gonorrhoeae: roles for cytochromes c4 and c5, but not cytochrome c2, in oxygen reduction.

Publication Date: 2010 Feb 12 PMID: 20154126
Authors: Li, Y. - Hopper, A. - Overton, T. - Squire, D. J. - Cole, J. - Tovell, N.
Journal: J Bacteriol

Although Neisseria gonorrhoeae is a prolific source of eight c-type cytochromes, little is known about how its electron transfer pathways to oxygen are organised. In this study, the roles in the respiratory chain to oxygen of cytochromes c2, c4 and c5 encoded by genes cccA, cycA and cycB, respectively, have been investigated. Single mutations in genes for either cytochrome c4 or c5 resulted in increased sensitivity to growth inhibition by excess oxygen and small decreases in the respiratory capacity of the parent, which were complemented by chromosomal integration of an ectopic, IPTG-inducible copy of the cycA or cycB gene. In contrast, a cccA mutant reduced oxygen slightly more rapidly than the parent, suggesting that cccA is expressed, but cytochrome c2 is not involved in electron transfer to cytochrome oxidase. Deletion of cccA increased the sensitivity of the cycB mutant to excess oxygen, but decreased the sensitivity of the cycA mutant. Despite many attempts, a double mutant defective in both cytochromes c4 and c5 could not be isolated. However, a strain with the ectopically-encoded, IPTG-inducible cycB gene with deletions in both cycA and cycB was constructed: growth and survival of this strain was dependent upon the addition of IPTG, so gonococcal survival is dependent upon synthesis of either cytochrome c4 or c5. These results define the gonococcal electron transfer chain to oxygen in which cytochromes c4 and c5, but not cytochrome c2, provide alternative pathways for electron transfer from the cytochrome bc1 complex to the terminal oxidase, cytochrome cbb3.

post to: CiteULike

Analysis of protein expression regulated by the Helicobacter pylori ArsRS two-component signal transduction system.

Publication Date: 2010 Feb 12 PMID: 20154125
Authors: Loh, J. T. - Gupta, S. S. - Friedman, D. B. - Krezel, A. M. - Cover, T. L.
Journal: J Bacteriol

Previous studies have shown that the Helicobacter pylori ArsRS two-component signal transduction system contributes to acid-responsive gene expression. To identify additional members of the ArsRS regulon and further investigate the regulatory role of the ArsRS system, we analyzed protein expression in wild-type and arsS null mutant strains. Numerous proteins were differentially expressed in an arsS mutant strain compared to a wild-type strain when the bacteria were cultured at pH 5.0, and also when cultured at pH 7.0. Genes encoding 14 of these proteins were directly regulated by the ArsRS system, based on observed binding of ArsR to the relevant promoter regions. The ArsRS-regulated proteins identified in this study contribute to acid resistance (urease and amidase), acetone metabolism (acetone carboxylase), resistance to oxidative stress (thioredoxin reductase), quorum sensing (Pfs) and several other functions. These results provide further definition of the ArsRS regulon, and underscore the importance of the ArsRS system in regulating expression of H. pylori proteins during bacterial growth at both neutral pH and acidic pH.

post to: CiteULike

The Twists and Turns of Enzyme Function.

Publication Date: 2010 Feb 12 PMID: 20154124
Authors: White, R. H.
Journal: J Bacteriol

This commentary addresses the recent discovery that CysJ, a component of sulfite reductase, also functions as the electron donor to YcbX, a molybdenum cofactor containing protein involved in the reduction of 6-N-hydroxylaminopurine to adenine.

post to: CiteULike

Di-adenosine tetraphosphate (Ap4A) metabolism impacts biofilm formation by Pseudomonas fluorescens via modulation of c-di-GMP-dependent pathways.

Publication Date: 2010 Feb 12 PMID: 20154123
Authors: Monds, R. D. - Newell, P. D. - Wagner, J. C. - Schwartzman, J. A. - Lu, W. - Rabinowitz, J. D. - O'Toole, G. A.
Journal: J Bacteriol

Dinucleoside tetraphosphates are common constituents of the cell and are thought to play diverse biological roles in organisms ranging from bacteria to humans. In this study we characterize two independent mechanisms by which diadenosine tetraphosphate (Ap4A) metabolism impacts biofilm formation by P. fluorescens. Null mutations of apaH, the gene encoding nucleoside tetraphosphate hydrolase, resulted in a marked increase in the cellular level of Ap4A. Concomitant with this increase, Pho regulon activation in low inorganic phosphate (Pi) conditions was severely compromised. As a consequence the apaH mutant is insensitive to Pho regulon-dependent inhibition of biofilm formation. In addition, we characterize a Pho-independent role for Ap4A metabolism in regulation of biofilm formation. In Pi replete conditions Ap4A metabolism was seen to impact expression and localization of LapA, the major adhesin regulating surface commitment by P. fluorescens. Increases in the level of c-di-GMP in the apaH mutant provide a likely explanation for increased localization of LapA to the outer membrane in response to elevated Ap4A concentrations. Increased levels of c-di-GMP in the apaH mutant were associated with increases in GTP, suggesting that elevated levels of Ap4A may promote de novo purine biosynthesis. In support of this idea, supplementation with adenine could partially suppress the biofilm and c-di-GMP phenotypes of the apaH mutant. We hypothesize that changes in substrate concentration (GTP) mediated by altered flux through nucleotide biosynthetic pathways may serve as a significant point of regulation for c-di-GMP biosynthesis and regulation of biofilm formation.

post to: CiteULike

Thermosensing function of the Escherichia coli redox sensor Aer.

Publication Date: 2010 Mar PMID: 20097863
Authors: Nishiyama, S. - Ohno, S. - Ohta, N. - Inoue, Y. - Fukuoka, H. - Ishijima, A. - Kawagishi, I.
Journal: J Bacteriol

Escherichia coli chemoreceptors can sense changes in temperature for thermotaxis. Here we found that the aerotaxis transducer Aer, a homolog of chemoreceptors lacking a periplasmic domain, mediates thermoresponses. We propose that thermosensing by the chemoreceptors is a general attribute of their highly conserved cytoplasmic domain (or their less conserved transmembrane domain).

post to: CiteULike

The ArcB sensor kinase of Escherichia coli autophosphorylates by an intramolecular reaction.

Publication Date: 2010 Mar PMID: 20097862
Authors: Pena-Sandoval, G. R. - Georgellis, D.
Journal: J Bacteriol

The Arc two-component system, comprising the ArcB sensor kinase and the ArcA response regulator, modulates the expression of numerous genes in response to the respiratory conditions of growth. ArcB is a tripartite histidine kinase whose activity is regulated by the oxidation of two cytosol-located redox-active cysteine residues that participate in intermolecular disulfide bond formation. Here we show that ArcB autophosphorylates through an intramolecular reaction which diverges from the usually envisaged intermolecular autophosphorylation of homodimeric histidine kinases.

post to: CiteULike

SufU is an essential iron-sulfur cluster scaffold protein in Bacillus subtilis.

Publication Date: 2010 Mar PMID: 20097860
Authors: Albrecht, A. G. - Netz, D. J. - Miethke, M. - Pierik, A. J. - Burghaus, O. - Peuckert, F. - Lill, R. - Marahiel, M. A.
Journal: J Bacteriol

Bacteria use three distinct systems for iron-sulfur (Fe/S) cluster biogenesis: the ISC, SUF, and NIF machineries. The ISC and SUF systems are widely distributed, and many bacteria possess both of them. In Escherichia coli, ISC is the major and constitutive system, whereas SUF is induced under iron starvation and/or oxidative stress. Genomic analysis of the Fe/S cluster biosynthesis genes in Bacillus subtilis suggests that this bacterium's genome encodes only a SUF system consisting of a sufCDSUB gene cluster and a distant sufA gene. Mutant analysis of the putative Fe/S scaffold genes sufU and sufA revealed that sufU is essential for growth under minimal standard conditions, but not sufA. The drastic growth retardation of a conditional mutant depleted of SufU was coupled with a severe reduction of aconitase and succinate dehydrogenase activities in total-cell lysates, suggesting a crucial function of SufU in Fe/S protein biogenesis. Recombinant SufU was devoid of Fe/S clusters after aerobic purification. Upon in vitro reconstitution, SufU bound an Fe/S cluster with up to approximately 1.5 Fe and S per monomer. The assembled Fe/S cluster could be transferred from SufU to the apo form of isopropylmalate isomerase Leu1, rapidly forming catalytically active [4Fe-4S]-containing holo-enzyme. In contrast to native SufU, its D43A variant carried a Fe/S cluster after aerobic purification, indicating that the cluster is stabilized by this mutation. Further, we show that apo-SufU is an activator of the cysteine desulfurase SufS by enhancing its activity about 40-fold in vitro. SufS-dependent formation of holo-SufU suggests that SufU functions as an Fe/S cluster scaffold protein tightly cooperating with the SufS cysteine desulfurase.

post to: CiteULike

Direct evidence for control of the pheromone-inducible prgQ operon of Enterococcus faecalis plasmid pCF10 by a countertranscript-driven attenuation mechanism.

Publication Date: 2010 Mar PMID: 20097859
Authors: Johnson, C. M. - Manias, D. A. - Haemig, H. A. - Shokeen, S. - Weaver, K. E. - Henkin, T. M. - Dunny, G. M.
Journal: J Bacteriol

The mating response of Enterococcus faecalis cells carrying the conjugative plasmid pCF10 is controlled by multiple regulatory circuits. Initiation of transcription of the prgQ conjugation operon is controlled by the peptide receptor protein PrgX; binding of the pheromone peptide cCF10 to PrgX abolishes PrgX repression, while binding of the inhibitor peptide iCF10 enhances repression. The results of molecular analysis of prgQ transcripts and genetic studies suggested that the elongation of prgQ transcripts past a putative terminator (IRS1) may be controlled by the interaction of nascent prgQ mRNAs with a small antisense RNA (Anti-Q) encoded within prgQ. Direct evidence for interaction of these RNAs, as well as the resulting effects on readthrough of prgQ transcription, has been limited. Here we report the results of experiments that (i) determine the inherent termination properties of prgQ transcripts in the absence of Anti-Q; (ii) determine the direct effects of the interaction of Anti-Q with nascent prgQ transcripts in the absence of complicating effects of the PrgX protein; and (iii) begin to dissect the structural components involved in these interactions. The results confirm the existence of alternative terminating and antiterminating forms of nascent prgQ transcripts in vivo and demonstrate that the interaction of Anti-Q with these transcripts leads to termination via inhibition of antiterminator formation. In vitro transcription assays support the major results of the in vivo studies. The data support a model for Anti-Q function suggested from recent studies of these RNAs and their interactions in vitro (S. Shokeen, C. M. Johnson, T. J. Greenfield, D. A. Manias, G. M. Dunny, and K. E. Weaver, submitted for publication).

post to: CiteULike

Binding of azole antibiotics to Staphylococcus aureus flavohemoglobin increases intracellular oxidative stress.

Publication Date: 2010 Mar PMID: 20097858
Authors: Nobre, L. S. - Todorovic, S. - Tavares, A. F. - Oldfield, E. - Hildebrandt, P. - Teixeira, M. - Saraiva, L. M.
Journal: J Bacteriol

In this work, we report that flavohemoglobin contributes to the azole susceptibility of Staphylococcus aureus. We first observed that deletion of the flavohemoglobin gene leads to an increase in the viability of imidazole-treated S. aureus cells and that reversion to the wild-type phenotype occurs upon expression of flavohemoglobin from a multicopy plasmid. Further spectroscopic analyses showed that miconazole, the most efficient azole antibiotic against S. aureus, ligates to heme of both oxidized and reduced flavohemoglobin. The binding of miconazole to oxidized flavohemoglobin, with an association constant of 1.7 x 10(6) M(-1), typical of a tight, specific binding equilibrium, results in augmentation of the superoxide production by the enzyme. These results are corroborated by in vivo studies showing that imidazole-treated S. aureus cells expressing flavohemoglobin contain a larger amount of reactive oxygen species. Moreover, it was observed that the survival of miconazole-treated S. aureus internalized by murine macrophages is higher for cells lacking flavohemoglobin. Altogether, the present data revealed that in S. aureus, flavohemoglobin enhances the antimicrobial activity of imidazoles via an increase of intracellular oxidative stress.

post to: CiteULike

The Zur-regulated ZinT protein is an auxiliary component of the high-affinity ZnuABC zinc transporter that facilitates metal recruitment during severe zinc shortage.

Publication Date: 2010 Mar PMID: 20097857
Authors: Petrarca, P. - Ammendola, S. - Pasquali, P. - Battistoni, A.
Journal: J Bacteriol

The pathways ensuring the efficient uptake of zinc are crucial for the ability of bacteria to multiply in the infected host. To better understand bacterial responses to zinc deficiency, we have investigated the role of the periplasmic protein ZinT in Salmonella enterica serovar Typhimurium. We have found that zinT expression is regulated by Zur and parallels that of ZnuA, the periplasmic component of the zinc transporter ZnuABC. Despite the fact that ZinT contributes to Salmonella growth in media containing little zinc, disruption of zinT does not significantly affect virulence in mice. The role of ZinT became clear using strains expressing a mutated form of ZnuA lacking a characteristic histidine-rich domain. In fact, Salmonella strains producing this modified form of ZnuA exhibited a ZinT-dependent capability to import zinc either in vitro or in infected mice, suggesting that ZinT and the histidine-rich region of ZnuA have redundant function. The hypothesis that ZinT and ZnuA cooperate in the process of zinc recruitment is supported by the observation that they form a stable binary complex in vitro. Although the presence of ZinT is not strictly required to ensure the functionality of the ZnuABC transporter, our data suggest that ZinT facilitates metal acquisition during severe zinc shortage.

post to: CiteULike

PcaO positively regulates pcaHG of the beta-ketoadipate pathway in Corynebacterium glutamicum.

Publication Date: 2010 Mar PMID: 20081038
Authors: Zhao, K. X. - Huang, Y. - Chen, X. - Wang, N. X. - Liu, S. J.
Journal: J Bacteriol

We identified a new regulator, PcaO, which is involved in regulation of the protocatechuate (PCA) branch of the beta-ketoadipate pathway in Corynebacterium glutamicum. PcaO is an atypical large ATP-binding LuxR family (LAL)-type regulator and does not have a Walker A motif. A mutant of C. glutamicum in which pcaO was disrupted (RES167DeltapcaO) was unable to grow on PCA, and growth on PCA was restored by complementation with pcaO. Both an enzymatic assay of PCA 3,4-dioxygenase activity (encoded by pcaHG) and transcriptional analysis of pcaHG by reverse transcription-PCR revealed that PcaO positively regulated pcaHG. A promoter-LacZ transcriptional fusion assay suggested that PcaO interacted with the sequence upstream of pcaHG. Electrophoretic mobility shift assay (EMSA) analysis indicated that an imperfect palindromic sequence ((-78)AACCCCTGACCTTCGGGGTT(-59)) that was located upstream of the -35 region of the pcaHG promoter was essential for PcaO regulation. DNase I footprinting showed that this imperfect palindrome was protected from DNase I digestion. Site-directed mutation and EMSA tests revealed that this palindrome sequence was essential for PcaO binding to the DNA fragment. In vitro EMSA results showed that ATP weakened the binding between PcaO and its target sequence but ADP strengthened this binding, while the effect of protocatechuate on PcaO binding was dependent on the protocatechuate concentration.

post to: CiteULike

Heavy involvement of stringent transcription control depending on the adenine or guanine species of the transcription initiation site in glucose and pyruvate metabolism in Bacillus subtilis.

Publication Date: 2010 Mar PMID: 20081037
Authors: Tojo, S. - Kumamoto, K. - Hirooka, K. - Fujita, Y.
Journal: J Bacteriol

In Bacillus subtilis cells, the GTP level decreases and the ATP level increases upon a stringent response. This reciprocal change in the concentrations of the substrates of RNA polymerase affects the rate of transcription initiation of certain stringent genes depending on the purine species at their transcription initiation sites. DNA microarray analysis suggested that not only the rrn and ilv-leu genes encoding rRNAs and the enzymes for synthesis of branched-chain amino acids, respectively, but also many genes, including genes involved in glucose and pyruvate metabolism, might be subject to this kind of stringent transcription control. Actually, the ptsGHI and pdhABCD operons encoding the glucose-specific phosphoenolpyruvate:sugar phosphotransferase system and the pyruvate dehydrogenase complex were found to be negatively regulated, like rrn, whereas the pycA gene encoding pyruvate carboxylase and the alsSD operon for synthesis of acetoin from pyruvate were positively regulated, like ilv-leu. Replacement of the guanine at position 1 and/or position 2 of ptsGHI and at position 1 of pdhABCD (transcription initiation base at position 1) by adenine changed the negative stringent control of these operons in the positive direction. The initiation bases for transcription of pdhABCD and pycA were newly determined. Then the promoter sequences of these stringent operons were aligned, and the results suggested that the presence of a guanine(s) and the presence of an adenine(s) at position 1 and/or position 2 might be indispensable for negative and positive stringent control, respectively. Such stringent transcription control that affects the transcription initiation rate through reciprocal changes in the GTP and ATP levels likely occurs for numerous genes of B. subtilis.

post to: CiteULike

Identification and regulation of the N-acetylglucosamine utilization pathway of the plant pathogenic bacterium Xanthomonas campestris pv. campestris.

Publication Date: 2010 Mar PMID: 20081036
Authors: Boulanger, A. - Dejean, G. - Lautier, M. - Glories, M. - Zischek, C. - Arlat, M. - Lauber, E.
Journal: J Bacteriol

Xanthomonas campestris pv. campestris, the causal agent of black rot disease of brassicas, is known for its ability to catabolize a wide range of plant compounds. This ability is correlated with the presence of specific carbohydrate utilization loci containing TonB-dependent transporters (CUT loci) devoted to scavenging specific carbohydrates. In this study, we demonstrate that there is an X. campestris pv. campestris CUT system involved in the import and catabolism of N-acetylglucosamine (GlcNAc). Expression of genes belonging to this GlcNAc CUT system is under the control of GlcNAc via the LacI family NagR and GntR family NagQ regulators. Analysis of the NagR and NagQ regulons confirmed that GlcNAc utilization involves NagA and NagB-II enzymes responsible for the conversion of GlcNAc-6-phosphate to fructose-6-phosphate. Mutants with mutations in the corresponding genes are sensitive to GlcNAc, as previously reported for Escherichia coli. This GlcNAc sensitivity and analysis of the NagQ and NagR regulons were used to dissect the X. campestris pv. campestris GlcNAc utilization pathway. This analysis revealed specific features, including the fact that uptake of GlcNAc through the inner membrane occurs via a major facilitator superfamily transporter and the fact that this amino sugar is phosphorylated by two proteins belonging to the glucokinase family, NagK-IIA and NagK-IIB. However, NagK-IIA seems to play a more important role in GlcNAc utilization than NagK-IIB under our experimental conditions. The X. campestris pv. campestris GlcNAc NagR regulon includes four genes encoding TonB-dependent active transporters (TBDTs). However, the results of transport experiments suggest that GlcNAc passively diffuses through the bacterial envelope, an observation that calls into question whether GlcNAc is a natural substrate for these TBDTs and consequently is the source of GlcNAc for this nonchitinolytic plant-associated bacterium.

post to: CiteULike

Systematic domain deletion analysis of the major sporulation kinase in Bacillus subtilis.

Publication Date: 2010 Mar PMID: 20081035
Authors: Eswaramoorthy, P. - Fujita, M.
Journal: J Bacteriol

To characterize the role of the three PAS domains in KinA, the major sporulation kinase in Bacillus subtilis, we constructed a series of systematic PAS domain deletion mutants and analyzed their activities using an IPTG (isopropyl-beta-d-thiogalactopyranoside)-inducible artificial sporulation induction system, which we have developed recently. The results showed that any one of the three PAS domains is sufficient to maintain the kinase activity and trigger sporulation, if not fully then at least partially, when the protein levels increase beyond a certain level.

post to: CiteULike

Inactivation of genes encoding plastoglobuli-like proteins in Synechocystis sp. PCC 6803 leads to a light-sensitive phenotype.

Publication Date: 2010 Mar PMID: 20081034
Authors: Cunningham, F. X. Jr - Tice, A. B. - Pham, C. - Gantt, E.
Journal: J Bacteriol

Plastoglobulins (PGL) are the predominant proteins of lipid globules in the plastids of flowering plants. Genes encoding proteins similar to plant PGL are also present in algae and cyanobacteria but in no other organisms, suggesting an important role for these proteins in oxygenic photosynthesis. To gain an understanding of the core and fundamental function of PGL, the two genes that encode PGL-like polypeptides in the cyanobacterium Synechocystis sp. PCC 6803 (pgl1 and pgl2) were inactivated individually and in combination. The resulting mutants were able to grow under photoautotrophic conditions, dividing at rates that were comparable to that of the wild-type (WT) under low-light (LL) conditions (10 microeinsteins x m(-2) x s(-1)) but lower than that of the WT under moderately high-irradiance (HL) conditions (150 microeinsteins x m(-2) x s(-1)). Under HL, each Deltapgl mutant had less chlorophyll, a lower photosystem I (PSI)/PSII ratio, more carotenoid per unit of chlorophyll, and very much more myxoxanthophyll (a carotenoid symptomatic of high light stress) per unit of chlorophyll than the WT. Large, heterogeneous inclusion bodies were observed in cells of mutants inactivated in pgl2 or both pgl2 and pgl1 under both LL and HL conditions. The mutant inactivated in both pgl genes was especially sensitive to the light environment, with alterations in pigmentation, heterogeneous inclusion bodies, and a lower PSI/PSII ratio than the WT even for cultures grown under LL conditions. The WT cultures grown under HL contained 2- to 3-fold more PGL1 and PGL2 per cell than cultures grown under LL conditions. These and other observations led us to conclude that the PGL-like polypeptides of Synechocystis play similar but not identical roles in some process relevant to the repair of photooxidative damage.

post to: CiteULike

The Sinorhizobium meliloti RNA chaperone Hfq mediates symbiosis of S. meliloti and alfalfa.

Publication Date: 2010 Mar PMID: 20081033
Authors: Barra-Bily, L. - Pandey, S. P. - Trautwetter, A. - Blanco, C. - Walker, G. C.
Journal: J Bacteriol

There exist commonalities between symbiotic Sinorhizobium meliloti and pathogenic Brucella bacteria in terms of extensive gene synteny and the requirements for intracellular survival in their respective hosts. The RNA chaperone Hfq is essential for virulence for several bacterial groups, including Brucella; however, its role in S. meliloti has not been investigated. Our studies of an S. meliloti loss-of-function hfq mutant have revealed that Hfq plays a key role in the establishment of the symbiosis between S. meliloti and its host Medicago sativa. S. meliloti Hfq is involved in controlling the population density under a free-living state and affects the growth parameters and nodulation. An hfq mutant poorly colonizes the infection threads that are necessary for the bacteria to invade the developing nodule. An hfq mutant is severely impaired in its ability to invade plant cells within the nodule, which leads to the formation of small, ineffective nodules unable to fix nitrogen. In culture, the hfq mutant did not accumulate transcripts of nifA, which encodes a key regulator necessary for nitrogen fixation. Hfq may be involved in regulation of several proteins relevant to hfq mutant phenotypes. The crucial role of Hfq in symbiosis suggests that small regulatory RNAs are important for its interactions with its plant host.

post to: CiteULike

Proteomic alterations explain phenotypic changes in Sinorhizobium meliloti lacking the RNA chaperone Hfq.

Publication Date: 2010 Mar PMID: 20081032
Authors: Barra-Bily, L. - Fontenelle, C. - Jan, G. - Flechard, M. - Trautwetter, A. - Pandey, S. P. - Walker, G. C. - Blanco, C.
Journal: J Bacteriol

The ubiquitous bacterial RNA-binding protein Hfq is involved in stress resistance and pathogenicity. In Sinorhizobium meliloti, Hfq is essential for the establishment of symbiosis with Medicago sativa and for nitrogen fixation. A proteomic analysis identifies 55 proteins with significantly affected expression in the hfq mutant; most of them are involved in cell metabolism or stress resistance. Important determinants of oxidative stress resistance, such as CysK, Gsh, Bfr, SodC, KatB, KatC, and a putative peroxiredoxine (SMc00072), are downregulated in the hfq mutant. The hfq mutant is affected for H(2)O(2), menadione, and heat stress resistance. Part of these defects could result from the reductions of rpoE1, rpoE2, rpoE3, and rpoE4 expression levels in the hfq mutant. Some proteins required for efficient symbiosis are reduced in the hfq mutant, contributing to the drastic defect in nodulation observed in this mutant.

post to: CiteULike

The receiver domain of hybrid histidine kinase VirA: an enhancing factor for vir gene expression in Agrobacterium tumefaciens.

Publication Date: 2010 Mar PMID: 20081031
Authors: Wise, A. A. - Fang, F. - Lin, Y. H. - He, F. - Lynn, D. G. - Binns, A. N.
Journal: J Bacteriol

The plant pathogen Agrobacterium tumefaciens expresses virulence (vir) genes in response to chemical signals found at the site of a plant wound. VirA, a hybrid histidine kinase, and its cognate response regulator, VirG, regulate vir gene expression. The receiver domain at the carboxyl end of VirA has been described as an inhibitory element because its removal increased vir gene expression relative to that of full-length VirA. However, experiments that characterized the receiver region as an inhibitory element were performed in the presence of constitutively expressed virG. We show here that VirA's receiver domain is an activating factor if virG is expressed from its native promoter on the Ti plasmid. When virADeltaR was expressed from a multicopy plasmid, both sugar and the phenolic inducer were essential for vir gene expression. Replacement of wild-type virA on pTi with virADeltaR precluded vir gene induction, and the cells did not accumulate VirG or induce transcription of a virG-lacZ fusion in response to acetosyringone. These phenotypes were corrected if the virG copy number was increased. In addition, we show that the VirA receiver domain can interact with the VirG DNA-binding domain.

post to: CiteULike

Functional analysis of the three TATA binding protein homologs in Methanosarcina acetivorans.

Publication Date: 2010 Mar PMID: 20081030
Authors: Reichlen, M. J. - Murakami, K. S. - Ferry, J. G.
Journal: J Bacteriol

The roles of three TATA binding protein (TBP) homologs (TBP1, TBP2, and TBP3) in the archaeon Methanosarcina acetivorans were investigated by using genetic and molecular approaches. Although tbp2 and tbp3 deletion mutants were readily obtained, a tbp1 mutant was not obtained, and the growth of a conditional tbp1 expression strain was tetracycline dependent, indicating that TBP1 is essential. Transcripts of tbp1 were 20-fold more abundant than transcripts of tbp2 and 100- to 200-fold more abundant than transcripts of tbp3, suggesting that TBP1 is the primary TBP utilized during growth. Accordingly, tbp1 is strictly conserved in the genomes of Methanosarcina species. Deltatbp3 and Deltatbp2 strains exhibited an extended lag phase compared with the wild type, although the lag phase for the Deltatbp2 strain was less pronounced when this strain was transitioning from growth on methylotrophic substrates to growth on acetate. Acetate-adapted Deltatbp3 cells exhibited growth rates, final growth yields, and lag times that were significantly reduced compared with those of the wild type when the organisms were cultured with growth-limiting concentrations of acetate, and the acetate-adapted Deltatbp2 strain exhibited a final growth yield that was reduced compared with that of the wild type when the organisms were cultured with growth-limiting acetate concentrations. DNA microarray analyses identified 92 and 77 genes with altered transcription in the Deltatbp2 and Deltatbp3 strains, respectively, which is consistent with a role for TBP2 and TBP3 in optimizing gene expression. Together, the results suggest that TBP2 and TBP3 are required for efficient growth under conditions similar to the conditions in the native environment of M. acetivorans.

post to: CiteULike

Identification of tail genes in the temperate phage 16-3 of Sinorhizobium meliloti 41.

Publication Date: 2010 Mar PMID: 20081029
Authors: Deak, V. - Lukacs, R. - Buzas, Z. - Palvolgyi, A. - Papp, P. P. - Orosz, L. - Putnoky, P.
Journal: J Bacteriol

Genes encoding the tail proteins of the temperate phage 16-3 of the symbiotic nitrogen-fixing bacterium Sinorhizobium meliloti 41 have been identified. First, a new host range gene, designated hII, was localized by using missense mutations. The corresponding protein was shown to be identical to the 85-kDa tail protein by determining its N-terminal sequence. Electron microscopic analysis showed that phage 16-3 possesses an icosahedral head and a long, noncontractile tail characteristic of the Siphoviridae. By using a lysogenic S. meliloti 41 strain, mutants with insertions in the putative tail region of the genome were constructed and virion morphology was examined after induction of the lytic cycle. Insertions in ORF017, ORF018a, ORF020, ORF021, the previously described h gene, and hII resulted in uninfectious head particles lacking tail structures, suggesting that the majority of the genes in this region are essential for tail formation. By using different bacterial mutants, it was also shown that not only the RkpM and RkpY proteins but also the RkpZ protein of the host takes part in the formation of the phage receptor. Results for the host range phage mutants and the receptor mutant bacteria suggest that the HII tail protein interacts with the capsular polysaccharide of the host and that the tail protein encoded by the original h gene recognizes a proteinaceous receptor.

post to: CiteULike

RamA, a member of the AraC/XylS family, influences both virulence and efflux in Salmonella enterica serovar Typhimurium.

Publication Date: 2010 Mar PMID: 20081028
Authors: Bailey, A. M. - Ivens, A. - Kingsley, R. - Cottell, J. L. - Wain, J. - Piddock, L. J.
Journal: J Bacteriol

The transcriptomes of Salmonella enterica serovar Typhimurium SL1344 lacking a functional ramA or ramR or with plasmid-mediated high-level overexpression of ramA were compared to those of the wild-type parental strain. Inactivation of ramA led to increased expression of 14 SPI-1 genes and decreased expression of three SPI-2 genes, and it altered expression of ribosomal biosynthetic genes and several amino acid biosynthetic pathways. Furthermore, disruption of ramA led to decreased survival within RAW 264.7 mouse macrophages and attenuation within the BALB/c ByJ mouse model. Highly overexpressed ramA led to increased expression of genes encoding multidrug resistance (MDR) efflux pumps, including acrAB, acrEF, and tolC. Decreased expression of 34 Salmonella pathogenicity island (SPI) 1 and 2 genes, decreased SipC production, decreased adhesion to and survival within macrophages, and decreased colonization of Caenorhabditis elegans were also seen. Disruption of ramR led to the increased expression of ramA, acrAB, and tolC, but not to the same level as when ramA was overexpressed on a plasmid. Inactivation of ramR had a more limited effect on pathogenicity gene expression. In silico analysis of a suggested RamA-binding consensus sequence identified target genes, including ramR, acrA, tolC, sipABC, and ssrA. This study demonstrates that the regulation of a mechanism of MDR and expression of virulence genes show considerable overlap, and we postulate that such a mechanism is dependent on transcriptional activator concentration and promoter sensitivity. However, we have no evidence to support the hypothesis that increased MDR via RamA regulation of AcrAB-TolC gives rise to a hypervirulent strain.

post to: CiteULike

F plasmid TraF and TraH are components of an outer membrane complex involved in conjugation.

Publication Date: 2010 Mar PMID: 20081027
Authors: Arutyunov, D. - Arenson, B. - Manchak, J. - Frost, L. S.
Journal: J Bacteriol

F plasmid TraF and TraH are required for F pilus assembly and F plasmid transfer. Using flotation sucrose density gradients, we found that TraF and TraH (as well as TraU and TraW) localized to the outer membrane in the presence of the complete F transfer region, especially TraV, the putative anchor. Mutational analysis of TraH revealed two domains that are important for its function and possible interaction with TrbI, which in turn has a role in stabilizing TraH.

post to: CiteULike

The three RelE homologs of Mycobacterium tuberculosis have individual, drug-specific effects on bacterial antibiotic tolerance.

Publication Date: 2010 Mar PMID: 20061486
Authors: Singh, R. - Barry, C. E. 3rd - Boshoff, H. I.
Journal: J Bacteriol

In Escherichia coli, expression of the RelE and HipA toxins in the absence of their cognate antitoxins has been associated with generating multidrug-tolerant "persisters." Here we show that unlike persisters of E. coli, persisters of Mycobacterium tuberculosis selected with one drug do not acquire cross-resistance to other classes of drugs. M. tuberculosis has three homologs of RelE arranged in operons with their apparent antitoxins. Each toxin individually arrests growth of both M. tuberculosis and E. coli, an effect that is neutralized by coexpression of the cognate antitoxin. Overexpression or deletion of each of the RelE toxins had a toxin- and drug-specific effect on the proportion of bacilli surviving antibiotic killing. All three toxins were upregulated in vivo, but none of the deletions affected survival during murine infection. RelE2 overexpression increased bacterial survival rates in the presence of rifampin in vitro, while deletion significantly decreased survival rates. Strikingly, deletion of this toxin had no discernible effect on the level of persisters seen in rifampin-treated mice. Our results suggest that, in vivo, RelE-generated persisters are unlikely to play a significant role in the generation of bacilli that survive in the face of multidrug therapy or in the generation of multidrug-resistant M. tuberculosis.

post to: CiteULike

FimR and FimS: biofilm formation and gene expression in Porphyromonas gingivalis.

Publication Date: 2010 Mar PMID: 20061484
Authors: Lo, A. - Seers, C. - Dashper, S. - Butler, C. - Walker, G. - Walsh, K. - Catmull, D. - Hoffmann, B. - Cleal, S. - Lissel, P. - Boyce, J. - Reynolds, E.
Journal: J Bacteriol

Porphyromonas gingivalis is a late-colonizing bacterium of the subgingival dental plaque biofilm associated with periodontitis. Two P. gingivalis genes, fimR and fimS, are predicted to encode a two-component signal transduction system comprising a response regulator (FimR) and a sensor histidine kinase (FimS). In this study, we show that fimS and fimR, although contiguous on the genome, are not part of an operon. We inactivated fimR and fimS in both the afimbriated strain W50 and the fimbriated strain ATCC 33277 and demonstrated that both mutants formed significantly less biofilm than their respective wild-type strains. Quantitative reverse transcription-real-time PCR showed that expression of fimbriation genes was reduced in both the fimS and fimR mutants of strain ATCC 33277. The mutations had no effect, in either strain, on the P. gingivalis growth rate or on the response to hydrogen peroxide or growth at pH 9, at 41 degrees C, or at low hemin availability. Transcriptome analysis using DNA microarrays revealed that inactivation of fimS resulted in the differential expression of 10% of the P. gingivalis genome (>1.5-fold; P < 0.05). Notably genes encoding seven different transcriptional regulators, including the fimR gene and three extracytoplasmic sigma factor genes, were differentially expressed in the fimS mutant.

post to: CiteULike

In Helicobacter pylori, LuxS is a key enzyme in cysteine provision through a reverse transsulfuration pathway.

Publication Date: 2010 Mar PMID: 20061483
Authors: Doherty, N. C. - Shen, F. - Halliday, N. M. - Barrett, D. A. - Hardie, K. R. - Winzer, K. - Atherton, J. C.
Journal: J Bacteriol

In many bacteria, LuxS functions as a quorum-sensing molecule synthase. However, it also has a second, more central metabolic function in the activated methyl cycle (AMC), which generates the S-adenosylmethionine required by methyltransferases and recycles the product via methionine. Helicobacter pylori lacks an enzyme catalyzing homocysteine-to-methionine conversion, rendering the AMC incomplete and thus making any metabolic role of H. pylori LuxS (LuxS(Hp)) unclear. Interestingly, luxS(Hp) is located next to genes annotated as cysK(Hp) and metB(Hp), involved in other bacteria in cysteine and methionine metabolism. We showed that isogenic strains carrying mutations in luxS(Hp), cysK(Hp), and metB(Hp) could not grow without added cysteine (whereas the wild type could), suggesting roles in cysteine synthesis. Growth of the DeltaluxS(Hp) mutant was restored by homocysteine or cystathionine and growth of the DeltacysK(Hp) mutant by cystathionine only. The DeltametB(Hp) mutant had an absolute requirement for cysteine. Metabolite analyses showed that S-ribosylhomocysteine accumulated in the DeltaluxS(Hp) mutant, homocysteine in the DeltacysK(Hp) mutant, and cystathionine in the DeltametB(Hp) mutant. This suggests that S-ribosylhomocysteine is converted by LuxS(Hp) to homocysteine (as in the classic AMC) and thence by CysK(Hp) to cystathionine and by MetB(Hp) to cysteine. In silico analysis suggested that cysK-metB-luxS were acquired by H. pylori from a Gram-positive source. We conclude that cysK-metB-luxS encode the capacity to generate cysteine from products of the incomplete AMC of H. pylori in a process of reverse transsulfuration. We recommend that the misnamed genes cysK(Hp) and metB(Hp) be renamed mccA (methionine-to-cysteine-conversion gene A) and mccB, respectively.

post to: CiteULike

DsrR, a novel IscA-like protein lacking iron- and Fe-S-binding functions, involved in the regulation of sulfur oxidation in Allochromatium vinosum.

Publication Date: 2010 Mar PMID: 20061482
Authors: Grimm, F. - Cort, J. R. - Dahl, C.
Journal: J Bacteriol

In the purple sulfur bacterium Allochromatium vinosum, the reverse-acting dissimilatory sulfite reductase (DsrAB) is the key enzyme responsible for the oxidation of intracellular sulfur globules. The genes dsrAB are the first and the gene dsrR is the penultimate of the 15 genes of the dsr operon in A. vinosum. Genes homologous to dsrR occur in a number of other environmentally important sulfur-oxidizing bacteria utilizing Dsr proteins. DsrR exhibits sequence similarities to A-type scaffolds, like IscA, that partake in the maturation of protein-bound iron-sulfur clusters. We used nuclear magnetic resonance (NMR) spectroscopy to solve the solution structure of DsrR and to show that the protein is indeed structurally highly similar to A-type scaffolds. However, DsrR does not retain the Fe-S- or the iron-binding ability of these proteins, which is due to the lack of all three highly conserved cysteine residues of IscA-like scaffolds. Taken together, these findings suggest a common function for DsrR and IscA-like proteins different from direct participation in iron-sulfur cluster maturation. An A. vinosum DeltadsrR deletion strain showed a significantly reduced sulfur oxidation rate that was fully restored upon complementation with dsrR in trans. Immunoblot analyses revealed a reduced level of DsrE and DsrL in the DeltadsrR strain. These proteins are absolutely essential for sulfur oxidation. Transcriptional and translational gene fusion experiments suggested the participation of DsrR in the posttranscriptional control of the dsr operon, similar to the alternative function of cyanobacterial IscA as part of the sense and/or response cascade set into action upon iron limitation.

post to: CiteULike

Two alternative pathways for the synthesis of the rare compatible solute mannosylglucosylglycerate in Petrotoga mobilis.

Publication Date: 2010 Mar PMID: 20061481
Authors: Fernandes, C. - Mendes, V. - Costa, J. - Empadinhas, N. - Jorge, C. - Lamosa, P. - Santos, H. - da Costa, M. S.
Journal: J Bacteriol

The compatible solute mannosylglucosylglycerate (MGG), recently identified in Petrotoga miotherma, also accumulates in Petrotoga mobilis in response to hyperosmotic conditions and supraoptimal growth temperatures. Two functionally connected genes encoding a glucosyl-3-phosphoglycerate synthase (GpgS) and an unknown glycosyltransferase (gene Pmob_1143), which we functionally characterized as a mannosylglucosyl-3-phosphoglycerate synthase and designated MggA, were identified in the genome of Ptg. mobilis. This enzyme used the product of GpgS, glucosyl-3-phosphoglycerate (GPG), as well as GDP-mannose to produce mannosylglucosyl-3-phosphoglycerate (MGPG), the phosphorylated precursor of MGG. The MGPG dephosphorylation was determined in cell extracts, and the native enzyme was partially purified and characterized. Surprisingly, a gene encoding a putative glucosylglycerate synthase (Ggs) was also identified in the genome of Ptg. mobilis, and an active Ggs capable of producing glucosylglycerate (GG) from ADP-glucose and d-glycerate was detected in cell extracts and the recombinant enzyme was characterized, as well. Since GG has never been identified in this organism nor was it a substrate for the MggA, we anticipated the existence of a nonphosphorylating pathway for MGG synthesis. We putatively identified the corresponding gene, whose product had some sequence homology with MggA, but it was not possible to recombinantly express a functional enzyme from Ptg. mobilis, which we named mannosylglucosylglycerate synthase (MggS). In turn, a homologous gene from Thermotoga maritima was successfully expressed, and the synthesis of MGG was confirmed from GDP-mannose and GG. Based on the measurements of the relevant enzyme activities in cell extracts and on the functional characterization of the key enzymes, we propose two alternative pathways for the synthesis of the rare compatible solute MGG in Ptg. mobilis.

post to: CiteULike

Complete genome sequence of Listeria seeligeri, a nonpathogenic member of the genus Listeria.

Publication Date: 2010 Mar PMID: 20061480
Authors: Steinweg, C. - Kuenne, C. T. - Billion, A. - Mraheil, M. A. - Domann, E. - Ghai, R. - Barbuddhe, S. B. - Karst, U. - Goesmann, A. - Puhler, A. - Weisshaar, B. - Wehland, J. - Lampidis, R. - Kreft, J. - Goebel, W. - Chakraborty, T. - Hain, T.
Journal: J Bacteriol

We report the complete and annotated genome sequence of the nonpathogenic Listeria seeligeri SLCC3954 serovar 1/2b type strain harboring the smallest completely sequenced genome of the genus Listeria.

post to: CiteULike

Modified 3-oxoadipate pathway for the biodegradation of methylaromatics in Pseudomonas reinekei MT1.

Publication Date: 2010 Mar PMID: 20061479
Authors: Marin, M. - Perez-Pantoja, D. - Donoso, R. - Wray, V. - Gonzalez, B. - Pieper, D. H.
Journal: J Bacteriol

Catechols are central intermediates in the metabolism of aromatic compounds. Degradation of 4-methylcatechol via intradiol cleavage usually leads to the formation of 4-methylmuconolactone (4-ML) as a dead-end metabolite. Only a few microorganisms are known to mineralize 4-ML. The mml gene cluster of Pseudomonas reinekei MT1, which encodes enzymes involved in the metabolism of 4-ML, is shown here to encode 10 genes found in a 9.4-kb chromosomal region. Reverse transcription assays revealed that these genes form a single operon, where their expression is controlled by two promoters. Promoter fusion assays identified 4-methyl-3-oxoadipate as an inducer. Mineralization of 4-ML is initiated by the 4-methylmuconolactone methylisomerase encoded by mmlI. This reaction produces 3-ML and is followed by a rearrangement of the double bond catalyzed by the methylmuconolactone isomerase encoded by mmlJ. Deletion of mmlL, encoding a protein of the metallo-beta-lactamase superfamily, resulted in a loss of the capability of the strain MT1 to open the lactone ring, suggesting its function as a 4-methyl-3-oxoadipate enol-lactone hydrolase. Further metabolism can be assumed to occur by analogy with reactions known from the 3-oxoadipate pathway. mmlF and mmlG probably encode a 4-methyl-3-oxoadipyl-coenzyme A (CoA) transferase, and the mmlC gene product functions as a thiolase, transforming 4-methyl-3-oxoadipyl-CoA into methylsuccinyl-CoA and acetyl-CoA, as indicated by the accumulation of 4-methyl-3-oxoadipate in the respective deletion mutant. Accumulation of methylsuccinate by an mmlK deletion mutant indicates that the encoded acetyl-CoA hydrolase/transferase is crucial for channeling methylsuccinate into the central metabolism.

post to: CiteULike

PepD participates in the mycobacterial stress response mediated through MprAB and SigE.

Publication Date: 2010 Mar PMID: 20061478
Authors: White, M. J. - He, H. - Penoske, R. M. - Twining, S. S. - Zahrt, T. C.
Journal: J Bacteriol

Currently, one-third of the world's population is believed to be latently infected with Mycobacterium tuberculosis. The mechanisms by which M. tuberculosis establishes latent infection remain largely undefined. mprAB encodes a two-component signal transduction system required by M. tuberculosis for aspects of persistent infection. MprAB regulates a large and diverse group of genetic determinants in response to membrane stress, including the extracytoplasmic function (ECF) sigma factor sigE and the HtrA-like serine protease pepD. Recent studies have demonstrated that PepD functions as both a protease and chaperone in vitro. In addition, inactivation of pepD alters the virulence of M. tuberculosis in a mouse model system of infection. Here, we demonstrate that PepD plays an important role in the stress response network of Mycobacterium mediated through MprAB and SigE. In particular, we demonstrate that the protease activity of PepD requires the PDZ domain, in addition to the catalytic serine at position 317. pepD expression initiates from at least three promoters in M. tuberculosis, including one that is regulated by SigE and is located upstream of the mprA coding sequence. Deletion of pepD or mprAB in Mycobacterium smegmatis and M. tuberculosis alters the stress response phenotypes of these strains, including increasing sensitivity to SDS and cell wall antibiotics and upregulating the expression of stress-responsive determinants, including sigE. Taking these data together, we hypothesize that PepD utilizes its PDZ domain to recognize and process misfolded proteins at the cell membrane, leading to activation of the MprAB and SigE signaling pathways and subsequent establishment of a positive feedback loop that facilitates bacterial adaptation.

post to: CiteULike

Glycosylation of the collagen adhesin EmaA of Aggregatibacter actinomycetemcomitans is dependent upon the lipopolysaccharide biosynthetic pathway.

Publication Date: 2010 Mar PMID: 20061477
Authors: Tang, G. - Mintz, K. P.
Journal: J Bacteriol

The human oropharyngeal pathogen Aggregatibacter actinomycetemcomitans synthesizes multiple adhesins, including the nonfimbrial extracellular matrix protein adhesin A (EmaA). EmaA monomers trimerize to form antennae-like structures on the surface of the bacterium, which are required for collagen binding. Two forms of the protein have been identified, which are suggested to be linked with the type of O-polysaccharide (O-PS) of the lipopolysaccharide (LPS) synthesized (G. Tang et al., Microbiology 153:2447-2457, 2007). This association was investigated by generating individual mutants for a rhamnose sugar biosynthetic enzyme (rmlC; TDP-4-keto-6-deoxy-d-glucose 3,5-epimerase), the ATP binding cassette (ABC) sugar transport protein (wzt), and the O-antigen ligase (waaL). All three mutants produced reduced amounts of O-PS, and the EmaA monomers in these mutants displayed a change in their electrophoretic mobility and aggregation state, as observed in sodium dodecyl sulfate (SDS)-polyacrylamide gels. The modification of EmaA with O-PS sugars was suggested by lectin blots, using the fucose-specific Lens culinaris agglutinin (LCA). Fucose is one of the glycan components of serotype b O-PS. The rmlC mutant strain expressing the modified EmaA protein demonstrated reduced collagen adhesion using an in vitro rabbit heart valve model, suggesting a role for the glycoconjugant in collagen binding. These data provide experimental evidence for the glycosylation of an oligomeric, coiled-coil adhesin and for the dependence of the posttranslational modification of EmaA on the LPS biosynthetic machinery in A. actinomycetemcomitans.

post to: CiteULike

Characterization of a thioredoxin-thioredoxin reductase system from the hyperthermophilic bacterium Thermotoga maritima.

Publication Date: 2010 Mar PMID: 20061476
Authors: Yang, X. - Ma, K.
Journal: J Bacteriol

A thioredoxin reductase and a thioredoxin were purified to homogeneity from a cell extract of Thermotoga maritima. The thioredoxin reductase was a homodimeric flavin adenine dinucleotide (FAD)-containing protein with a subunit of 37 kDa estimated using SDS-PAGE, which was identified to be TM0869. The amino acid sequence of the enzyme showed high identities and similarities to those of typical bacterial thioredoxin reductases. Although the purified T. maritima thioredoxin reductase could not use thioredoxin from Spirulina as an electron acceptor, it used thioredoxin that was purified from T. maritima by monitoring the dithiothreitol-dependent reduction of bovine insulin. This enzyme also catalyzed the reduction of benzyl viologen using NADH or NADPH as an electron donor with apparent V(max) values of 1,111 +/- 35 micromol NADH oxidized min(-1)mg(-1) and 115 +/- 2.4 micromol NADPH oxidized min(-1)mg(-1), respectively. The apparent K(m) values were determined to be 89 +/- 1.1 microM, 73 +/- 1.6 microM, and 780 +/- 20 microM for benzyl viologen, NADH, and NADPH, respectively. Optimal pH values were determined to be 9.5 and 6.5 for NADH and NADPH, respectively. The enzyme activity increased along with the rise of temperature up to 95 degrees C, and more than 60% of the activity remained after incubation for 28 h at 80 degrees C. The purified T. maritima thioredoxin was a monomer with a molecular mass of 31 kDa estimated using SDS-PAGE and identified as TM0868, which exhibited both thioredoxin and thioltransferase activities. T. maritima thioredoxin and thioredoxin reductase together were able to reduce insulin or 5,5'-dithio-bis(2-nitrobenzoic acid) using NAD(P)H as an electron donor. This is the first thioredoxin-thioredoxin reductase system characterized from hyperthermophilic bacteria.

post to: CiteULike

The cyclic-di-GMP phosphodiesterase BinA negatively regulates cellulose-containing biofilms in Vibrio fischeri.

Publication Date: 2010 Mar PMID: 20061475
Authors: Bassis, C. M. - Visick, K. L.
Journal: J Bacteriol

Bacteria produce different types of biofilms under distinct environmental conditions. Vibrio fischeri has the capacity to produce at least two distinct types of biofilms, one that relies on the symbiosis polysaccharide Syp and another that depends upon cellulose. A key regulator of biofilm formation in bacteria is the intracellular signaling molecule cyclic diguanylate (c-di-GMP). In this study, we focused on a predicted c-di-GMP phosphodiesterase encoded by the gene binA, located directly downstream of syp, a cluster of 18 genes critical for biofilm formation and the initiation of symbiotic colonization of the squid Euprymna scolopes. Disruption or deletion of binA increased biofilm formation in culture and led to increased binding of Congo red and calcofluor, which are indicators of cellulose production. Using random transposon mutagenesis, we determined that the phenotypes of the DeltabinA mutant strain could be disrupted by insertions in genes in the bacterial cellulose biosynthesis cluster (bcs), suggesting that cellulose production is negatively regulated by BinA. Replacement of critical amino acids within the conserved EAL residues of the EAL domain disrupted BinA activity, and deletion of binA increased c-di-GMP levels in the cell. Together, these data support the hypotheses that BinA functions as a phosphodiesterase and that c-di-GMP activates cellulose biosynthesis. Finally, overexpression of the syp regulator sypG induced binA expression. Thus, this work reveals a mechanism by which V. fischeri inhibits cellulose-dependent biofilm formation and suggests that the production of two different polysaccharides may be coordinated through the action of the cellulose inhibitor BinA.

post to: CiteULike

Tricarboxylic acid cycle-dependent synthesis of Staphylococcus aureus Type 5 and 8 capsular polysaccharides.

Publication Date: 2010 Mar PMID: 20061474
Authors: Sadykov, M. R. - Mattes, T. A. - Luong, T. T. - Zhu, Y. - Day, S. R. - Sifri, C. D. - Lee, C. Y. - Somerville, G. A.
Journal: J Bacteriol

Staphylococcus aureus capsule synthesis requires the precursor N-acetyl-glucosamine; however, capsule is synthesized during post-exponential growth when the availability of N-acetyl-glucosamine is limited. Capsule biosynthesis also requires aerobic respiration, leading us to hypothesize that capsule synthesis requires tricarboxylic acid cycle intermediates. Consistent with this hypothesis, S. aureus tricarboxylic acid cycle mutants fail to make capsule.

post to: CiteULike

Two regions of Bacillus subtilis transcription factor SpoIIID allow a monomer to bind DNA.

Publication Date: 2010 Mar PMID: 20061473
Authors: Himes, P. - McBryant, S. J. - Kroos, L.
Journal: J Bacteriol

Nutrient limitation causes Bacillus subtilis to develop into two different cell types, a mother cell and a spore. SpoIIID is a key regulator of transcription in the mother cell and positively or negatively regulates more than 100 genes, in many cases by binding to the promoter region. SpoIIID was predicted to have a helix-turn-helix motif for sequence-specific DNA binding, and a 10-bp consensus sequence was recognized in binding sites, but some strong binding sites were observed to contain more than one match to the consensus sequence, suggesting that SpoIIID might bind as a dimer or cooperatively as monomers. Here we show that SpoIIID binds with high affinity as a monomer to a single copy of its recognition sequence. Using charge reversal substitutions of residues likely to be exposed on the surface of SpoIIID and assays for transcriptional activation in vivo and for DNA binding in vitro, we identify two regions essential for DNA binding, the putative recognition helix of the predicted helix-turn-helix motif and a basic region near the C terminus. SpoIIID is unusual among prokaryotic DNA-binding proteins with a single helix-turn-helix motif in its ability to bind DNA monomerically with high affinity. We propose that the C-terminal basic region of SpoIIID makes additional contacts with DNA, analogous to the N-terminal arm of eukaryotic homeodomain proteins and the "wings" of winged-helix proteins, but structurally distinct. SpoIIID is highly conserved only among bacteria that form endospores, including several important human pathogens. The need to conserve biosynthetic capacity during endospore formation might have favored the evolution of a small transcription factor capable of high-affinity binding to DNA as a monomer, and this unusual mode of DNA binding could provide a target for drug design.

post to: CiteULike

TnpR encoded by an ISPpu12 isoform regulates transposition of two different ISL3-like insertion sequences in Pseudomonas stutzeri after conjugative interaction.

Publication Date: 2010 Mar PMID: 20061472
Authors: Christie-Oleza, J. A. - Nogales, B. - Lalucat, J. - Bosch, R.
Journal: J Bacteriol

Pseudomonas stutzeri AN10 has two ISL3-like insertion sequences (ISs). One of them has been recently described as ISPst9. In this study we show that the second IS, situated 4.5 kb upstream of ISPst9, is an isoform of ISPpu12 from Pseudomonas putida mt-2. Although both ISL3-like ISs are flanked by nearly identical (21/24 conserved residues) inverted repeats (IRs) and harbor similar transposases (93% amino acid identity), they differ in their accompanying genes. As described for ISPst9, the isoform of ISPpu12 also transposes by a conservative mechanism, forms circular double-stranded DNA (dsDNA) transposition intermediates, and is induced by interaction with the conjugative strain Escherichia coli S17-1lambda(pir) (conjugative interaction) but not with the nonconjugative E. coli DH5alpha. In fact, we demonstrate that ISPst9 transposition after conjugative interaction occurs only when ISPpu12 is present, indicating that ISPpu12 is upregulating transposition of both ISs under such conditions. We also demonstrate that this conjugative interaction-mediated induction of ISPpu12 is not exclusive to the P. stutzeri AN10 strain but is a more general phenomenon, at least in Pseudomonas. Mutation of TnpR, a MerR-like transcriptional regulator present in ISPpu12 but not in ISPst9, reduced the transcription of tnpA (ISPpu12 transposase-encoding gene) and decreased formation of circular dsDNA transposition intermediates after conjugative interaction. Complementation of the TnpR mutant restored the phenotype. In addition, the presence of TnpR in an ISPpu12-free genetic background did not induce ISPst9 after conjugative interaction. Thus, our results suggest that TnpR, after conjugative interaction, activates transcription of tnpA of ISPpu12. Then, TnpA of ISPpu12 would bind to IRs of both ISs, ISPpu12 and ISPst9, causing their transposition.

post to: CiteULike

The Helicobacter pylori GroES cochaperonin HspA functions as a specialized nickel chaperone and sequestration protein through its unique C-terminal extension.

Publication Date: 2010 Mar PMID: 20061471
Authors: Schauer, K. - Muller, C. - Carriere, M. - Labigne, A. - Cavazza, C. - De Reuse, H.
Journal: J Bacteriol

The transition metal nickel plays a central role in the human gastric pathogen Helicobacter pylori because it is required for two enzymes indispensable for colonization, the nickel metalloenzyme urease and [NiFe] hydrogenase. To sustain nickel availability for these metalloenzymes while providing protection from the metal's harmful effects, H. pylori is equipped with several specific nickel-binding proteins. Among these, H. pylori possesses a particular chaperone, HspA, that is a homolog of the highly conserved and essential bacterial heat shock protein GroES. HspA contains a unique His-rich C-terminal extension and was demonstrated to bind nickel in vitro. To investigate the function of this extension in H. pylori, we constructed mutants carrying either a complete deletion or point mutations in critical residues of this domain. All mutants presented a decreased intracellular nickel content measured by inductively coupled plasma mass spectrometry (ICP-MS) and reduced nickel tolerance. While urease activity was unaffected in the mutants, [NiFe] hydrogenase activity was significantly diminished when the C-terminal extension of HspA was mutated. We conclude that H. pylori HspA is involved in intracellular nickel sequestration and detoxification and plays a novel role as a specialized nickel chaperone involved in nickel-dependent maturation of hydrogenase.

post to: CiteULike

Coordinating production and distribution: the Pseudomonas aeruginosa ExsACDE regulatory cascade.

Publication Date: 2010 Mar PMID: 20061470
Authors: Plano, G. V.
Journal: J Bacteriol

post to: CiteULike

The chemoreceptor dimer is the unit of conformational coupling and transmembrane signaling.

Publication Date: 2010 Mar PMID: 20061469
Authors: Amin, D. N. - Hazelbauer, G. L.
Journal: J Bacteriol

Transmembrane chemoreceptors are central components in bacterial chemotaxis. Receptors couple ligand binding and adaptational modification to receptor conformation in processes that create transmembrane signaling. Homodimers, the fundamental receptor structural units, associate in trimers and localize in patches of thousands. To what degree do conformational coupling and transmembrane signaling require higher-order interactions among dimers? To what degree are they altered by such interactions? To what degree are they inherent features of homodimers? We addressed these questions using nanodiscs to create membrane environments in which receptor dimers had few or no potential interaction partners. Receptors with many, few, or no interaction partners were tested for conformational changes and transmembrane signaling in response to ligand occupancy and adaptational modification. Conformation was assayed by measuring initial rates of receptor methylation, a parameter independent of receptor-receptor interactions. Coupling of ligand occupancy and adaptational modification to receptor conformation and thus to transmembrane signaling occurred with essentially the same sensitivity and magnitude in isolated dimers as for dimers with many neighbors. Thus, we conclude that the chemoreceptor dimer is the fundamental unit of conformational coupling and transmembrane signaling. This implies that in signaling complexes, coupling and transmembrane signaling occur through individual dimers and that changes between dimers in a receptor trimer or among trimer-based signaling complexes are subsequent steps in signaling.

post to: CiteULike

Genome sequence of the deep-rooted Yersinia pestis strain Angola reveals new insights into the evolution and pangenome of the plague bacterium.

Publication Date: 2010 Mar PMID: 20061468
Authors: Eppinger, M. - Worsham, P. L. - Nikolich, M. P. - Riley, D. R. - Sebastian, Y. - Mou, S. - Achtman, M. - Lindler, L. E. - Ravel, J.
Journal: J Bacteriol

To gain insights into the origin and genome evolution of the plague bacterium Yersinia pestis, we have sequenced the deep-rooted strain Angola, a virulent Pestoides isolate. Its ancient nature makes this atypical isolate of particular importance in understanding the evolution of plague pathogenicity. Its chromosome features a unique genetic make-up intermediate between modern Y. pestis isolates and its evolutionary ancestor, Y. pseudotuberculosis. Our genotypic and phenotypic analyses led us to conclude that Angola belongs to one of the most ancient Y. pestis lineages thus far sequenced. The mobilome carries the first reported chimeric plasmid combining the two species-specific virulence plasmids. Genomic findings were validated in virulence assays demonstrating that its pathogenic potential is distinct from modern Y. pestis isolates. Human infection with this particular isolate would not be diagnosed by the standard clinical tests, as Angola lacks the plasmid-borne capsule, and a possible emergence of this genotype raises major public health concerns. To assess the genomic plasticity in Y. pestis, we investigated the global gene reservoir and estimated the pangenome at 4,844 unique protein-coding genes. As shown by the genomic analysis of this evolutionary key isolate, we found that the genomic plasticity within Y. pestis clearly was not as limited as previously thought, which is strengthened by the detection of the largest number of isolate-specific single-nucleotide polymorphisms (SNPs) currently reported in the species. This study identified numerous novel genetic signatures, some of which seem to be intimately associated with plague virulence. These markers are valuable in the development of a robust typing system critical for forensic, diagnostic, and epidemiological studies.

post to: CiteULike

Positions of Trp codons in the leader peptide-coding region of the at operon influence anti-trap synthesis and trp operon expression in Bacillus licheniformis.

Publication Date: 2010 Mar PMID: 20061467
Authors: Levitin, A. - Yanofsky, C.
Journal: J Bacteriol

Tryptophan, phenylalanine, tyrosine, and several other metabolites are all synthesized from a common precursor, chorismic acid. Since tryptophan is a product of an energetically expensive biosynthetic pathway, bacteria have developed sensing mechanisms to downregulate synthesis of the enzymes of tryptophan formation when synthesis of the amino acid is not needed. In Bacillus subtilis and some other Gram-positive bacteria, trp operon expression is regulated by two proteins, TRAP (the tryptophan-activated RNA binding protein) and AT (the anti-TRAP protein). TRAP is activated by bound tryptophan, and AT synthesis is increased upon accumulation of uncharged tRNA(Trp). Tryptophan-activated TRAP binds to trp operon leader RNA, generating a terminator structure that promotes transcription termination. AT binds to tryptophan-activated TRAP, inhibiting its RNA binding ability. In B. subtilis, AT synthesis is upregulated both transcriptionally and translationally in response to the accumulation of uncharged tRNA(Trp). In this paper, we focus on explaining the differences in organization and regulatory functions of the at operon's leader peptide-coding region, rtpLP, of B. subtilis and Bacillus licheniformis. Our objective was to correlate the greater growth sensitivity of B. licheniformis to tryptophan starvation with the spacing of the three Trp codons in its at operon leader peptide-coding region. Our findings suggest that the Trp codon location in rtpLP of B. licheniformis is designed to allow a mild charged-tRNA(Trp) deficiency to expose the Shine-Dalgarno sequence and start codon for the AT protein, leading to increased AT synthesis.

post to: CiteULike

The ferrichrome uptake pathway in Pseudomonas aeruginosa involves an iron release mechanism with acylation of the siderophore and recycling of the modified desferrichrome.

Publication Date: 2010 Mar PMID: 20047910
Authors: Hannauer, M. - Barda, Y. - Mislin, G. L. - Shanzer, A. - Schalk, I. J.
Journal: J Bacteriol

The uptake of iron into Pseudomonas aeruginosa is mediated by two major siderophores produced by the bacterium, pyoverdine and pyochelin. The bacterium is also able of utilize several heterologous siderophores of bacterial or fungal origin. In this work, we have investigated the iron uptake in P. aeruginosa PAO1 by the heterologous ferrichrome siderophore. (55)Fe uptake assays showed that ferrichrome is transported across the outer membrane primarily (80%) by the FiuA receptor and to a lesser extent (20%) by a secondary transporter. Moreover, we demonstrate that like in the uptake of ferripyoverdine and ferripyochelin, the energy required for both pathways of ferrichrome uptake is provided by the inner membrane protein TonB1. Desferrichrome-(55)Fe uptake in P. aeruginosa was also dependent on the expression of the permease FiuB, suggesting that this protein is the inner membrane transporter of the ferrisiderophore. A biomimetic fluorescent analogue of ferrichrome, RL1194, was used in vivo to monitor the kinetics of iron release from ferrichrome in P. aeruginosa in real time. This dissociation involves acylation of ferrichrome and its biomimetic analogue RL1194 and recycling of both modified siderophores into the extracellular medium. FiuC, an N-acetyltransferase, is certainly involved in this mechanism of iron release, since its mutation abolished desferrichrome-(55)Fe uptake. The acetylated derivative reacts with iron in the extracellular medium and is able to be taken up again by the cells. All these observations are discussed in light of the current knowledge concerning ferrichrome uptake in P. aeruginosa and in Escherichia coli.

post to: CiteULike

The apparent malate synthase activity of Rhodobacter sphaeroides is due to two paralogous enzymes, (3S)-Malyl-coenzyme A (CoA)/{beta}-methylmalyl-CoA lyase and (3S)- Malyl-CoA thioesterase.

Publication Date: 2010 Mar PMID: 20047909
Authors: Erb, T. J. - Frerichs-Revermann, L. - Fuchs, G. - Alber, B. E.
Journal: J Bacteriol

Assimilation of acetyl coenzyme A (acetyl-CoA) is an essential process in many bacteria that proceeds via the glyoxylate cycle or the ethylmalonyl-CoA pathway. In both assimilation strategies, one of the final products is malate that is formed by the condensation of acetyl-CoA with glyoxylate. In the glyoxylate cycle this reaction is catalyzed by malate synthase, whereas in the ethylmalonyl-CoA pathway the reaction is separated into two proteins: malyl-CoA lyase, a well-known enzyme catalyzing the Claisen condensation of acetyl-CoA with glyoxylate and yielding malyl-CoA, and an unidentified malyl-CoA thioesterase that hydrolyzes malyl-CoA into malate and CoA. In this study the roles of Mcl1 and Mcl2, two malyl-CoA lyase homologs in Rhodobacter sphaeroides, were investigated by gene inactivation and biochemical studies. Mcl1 is a true (3S)-malyl-CoA lyase operating in the ethylmalonyl-CoA pathway. Notably, Mcl1 is a promiscuous enzyme and catalyzes not only the condensation of acetyl-CoA and glyoxylate but also the cleavage of beta-methylmalyl-CoA into glyoxylate and propionyl-CoA during acetyl-CoA assimilation. In contrast, Mcl2 was shown to be the sought (3S)-malyl-CoA thioesterase in the ethylmalonyl-CoA pathway, which specifically hydrolyzes (3S)-malyl-CoA but does not use beta-methylmalyl-CoA or catalyze a lyase or condensation reaction. The identification of Mcl2 as thioesterase extends the enzyme functions of malyl-CoA lyase homologs that have been known only as "Claisen condensation" enzymes so far. Mcl1 and Mcl2 are both related to malate synthase, an enzyme which catalyzes both a Claisen condensation and thioester hydrolysis reaction.

post to: CiteULike

ATP-dependent carboxylation of acetophenone by a novel type of carboxylase.

Publication Date: 2010 Mar PMID: 20047908
Authors: Jobst, B. - Schuhle, K. - Linne, U. - Heider, J.
Journal: J Bacteriol

Anaerobic ethylbenzene metabolism in the betaproteobacterium Aromatoleum aromaticum is initiated by anaerobic oxidation to acetophenone via (S)-1-phenylethanol. The subsequent carboxylation of acetophenone to benzoylacetate is catalyzed by an acetophenone-induced enzyme, which has been purified and studied. The same enzyme is involved in acetophenone metabolism in the absence of ethylbenzene. Acetophenone carboxylase consists of five subunits with molecular masses of 70, 15, 87, 75, and 34 kDa, whose genes (apcABCDE) form an apparent operon. The enzyme is synthesized at high levels in cells grown on ethylbenzene or acetophenone, but not in cells grown on benzoate. During purification, acetophenone carboxylase dissociates into inactive subcomplexes consisting of the 70-, 15-, 87-, and 75-kDa subunits (apcABCD gene products) and the 34-kDa subunit (apcE gene product), respectively. Acetophenone carboxylase activity was restored by mixing the purified subcomplexes. The enzyme contains 1 Zn(2+) ion per alphabetagammadelta core complex and is dependent on the presence of Mg(2+) or Mn(2+). In spite of the presence of Zn in the enzyme, it is strongly inhibited by Zn(2+) ions. Carboxylation of acetophenone is dependent on ATP hydrolysis to ADP and P(i), exhibiting a stoichiometry of 2 mol ATP per mol acetophenone carboxylated. The enzyme shows uncoupled ATPase activity with either bicarbonate or acetophenone in the absence of the second substrate. These observations indicate that both substrates may be phosphorylated, which is consistent with isotope exchange activity observed with deuterated acetophenone and inhibition by carbamoylphosphate, a structural analogue of carboxyphosphate. A potential mechanism of ATP-dependent acetophenone carboxylation is suggested.

post to: CiteULike

Complete genome sequence of Staphylococcus lugdunensis strain HKU09-01.

Publication Date: 2010 Mar PMID: 20047907
Authors: Tse, H. - Tsoi, H. W. - Leung, S. P. - Lau, S. K. - Woo, P. C. - Yuen, K. Y.
Journal: J Bacteriol

Staphylococcus lugdunensis is a member of the coagulase-negative staphylococci and commonly found as part of the human skin flora. It is a significant cause of catheter-related bacteremia and also causes serious infections like native valve endocarditis in previously healthy individuals. We report the complete genome sequence of this medically important bacterium.

post to: CiteULike

Superdormant spores of bacillus species germinate normally with high pressure, peptidoglycan fragments, and bryostatin.

Publication Date: 2010 Mar PMID: 20047906
Authors: Wei, J. - Shah, I. M. - Ghosh, S. - Dworkin, J. - Hoover, D. G. - Setlow, P.
Journal: J Bacteriol

Superdormant spores of Bacillus cereus and Bacillus subtilis germinated just as well as dormant spores with pressures of 150 or 500 MPa and with or without heat activation. Superdormant B. subtilis spores also germinated as well as dormant spores with peptidoglycan fragments or bryostatin, a Ser/Thr protein kinase activator.

post to: CiteULike

Multidrug efflux pump MdtBC of Escherichia coli is active only as a B2C heterotrimer.

Publication Date: 2010 Mar PMID: 20038594
Authors: Kim, H. S. - Nagore, D. - Nikaido, H.
Journal: J Bacteriol

RND (resistance-nodulation-division) family transporters in Gram-negative bacteria frequently pump out a wide range of inhibitors and often contribute to multidrug resistance to antibiotics and biocides. An archetypal RND pump of Escherichia coli, AcrB, is known to exist as a homotrimer, and this construction is essential for drug pumping through the functionally rotating mechanism. MdtBC, however, appears different because two pump genes coexist within a single operon, and genetic deletion data suggest that both pumps must be expressed in order for the drug efflux to occur. We have expressed the corresponding genes, with one of them in a His-tagged form. Copurification of MdtB and MdtC under these conditions showed that they form a complex, with an average stoichiometry of 2:1. Unequivocal evidence that only the trimer containing two B protomers and one C protomer is active was obtained by expressing all possible combinations of B and C in covalently linked forms. Finally, conversion into alanine of the residues, known to form a proton translocation pathway in AcrB, inactivated transport only when made in MdtB, not when made in MdtC, a result suggesting that MdtC plays a different role not directly involved in drug binding and extrusion.

post to: CiteULike

Sequence motifs and proteolytic cleavage of the collagen-like glycoprotein BclA required for its attachment to the exosporium of Bacillus anthracis.

Publication Date: 2010 Mar PMID: 20038593
Authors: Tan, L. - Turnbough, C. L. Jr
Journal: J Bacteriol

Bacillus anthracis spores are enclosed by an exosporium comprised of a basal layer and an external hair-like nap. The filaments of the nap are composed of trimers of the collagen-like glycoprotein BclA. The attachment of essentially all BclA trimers to the exosporium requires the basal layer protein BxpB, and both proteins are included in stable high-molecular-mass exosporium complexes. BclA contains a proteolytically processed 38-residue amino-terminal domain (NTD) that is essential for basal-layer attachment. In this report, we identify three NTD submotifs (SM1a, SM1b, and SM2, located within residues 21 to 33) that are important for BclA attachment and demonstrate that residue A20, the amino-terminal residue of processed BclA, is not required for attachment. We show that the shortest NTD of BclA-or of a recombinant protein-sufficient for high-level basal-layer attachment is a 10-residue motif consisting of an initiating methionine, an apparently arbitrary second residue, SM1a or SM1b, and SM2. We also demonstrate that cleavage of the BclA NTD is necessary for efficient attachment to the basal layer and that the site of cleavage is somewhat flexible, at least in certain mutant NTDs. Finally, we propose a mechanism for BclA attachment and discuss the possibility that analogous mechanisms are involved in the attachment of many different collagen-like proteins of B. anthracis and closely related Bacillus species.

post to: CiteULike

Coordinated regulation of 23S rRNA maturation in Escherichia coli.

Publication Date: 2010 Mar PMID: 20038592
Authors: Gutgsell, N. S. - Jain, C.
Journal: J Bacteriol

In Escherichia coli, rRNAs are transcribed as precursors and require processing at the 3' and 5' ends to generate mature RNA molecules. The largest of these RNAs, 23S rRNA, is matured at the 3' end by a set of exonucleases and at the 5' end by an unknown RNase. Whether the 3' and 5' maturation steps occur independently or are coupled has previously been unclear. By assessing the levels of precursors accumulating at the 3' and 5' ends, we provide evidence that these processes may be linked. Thus, each of several conditions that led to precursor accumulation at one end also did so at the other end. We also observed that each end undergoes maturation at similar rates, suggesting that the two processes could be coupled. Finally, we provide evidence that processing at the 3' end facilitates 5'-end maturation. A model to explain the basis for the observed directionality of the reactions is proposed. This information will aid in the search for the enzyme responsible for final maturation of the 5' end of 23S rRNA.

post to: CiteULike

The Streptococcus mutans IrvR repressor is a CI-like regulator that functions through autocleavage and Clp-dependent proteolysis.

Publication Date: 2010 Mar PMID: 20038591
Authors: Niu, G. - Okinaga, T. - Qi, F. - Merritt, J.
Journal: J Bacteriol

Previous work has shown that irvR is required for the proper regulation of genetic competence and dextran-dependent aggregation due to its ability to repress the transcription regulator irvA. In this study, we determined the mechanism used to relieve the repression of irvA. We demonstrate that IrvR is a "LexA-like" protein with four conserved amino acid residues likely required for IrvR autocleavage activity. Furthermore, recombinant IrvR protein purified from Escherichia coli was competent to undergo autocleavage in vitro. Using several truncated IrvR constructs, we show that the amino acids adjacent to the autocleavage site are essential for relieving irvA repression and engaging the irvA-dependent regulatory pathway primarily through the ClpXP and ClpCP proteases. By extending the IrvR C terminus with an epitope derived from the autocleavage site, we were also able to create a constitutive Clp-dependent degradation of the full-length IrvR protein. This suggests that the derepression of irvA occurs through a two-step mechanism involving the initial autocleavage of IrvR and exposure of a proteolytic degradation sequence followed by Clp-dependent degradation of the IrvR DNA binding domain. Thus, irvA derepression is highly analogous to the genetic switch mechanism used to regulate lysogeny in bacteriophages.

post to: CiteULike

Flavobacterium johnsoniae gldN and gldO are partially redundant genes required for gliding motility and surface localization of SprB.

Publication Date: 2010 Mar PMID: 20038590
Authors: Rhodes, R. G. - Samarasam, M. N. - Shrivastava, A. - van Baaren, J. M. - Pochiraju, S. - Bollampalli, S. - McBride, M. J.
Journal: J Bacteriol

Cells of the gliding bacterium Flavobacterium johnsoniae move rapidly over surfaces. Mutations in gldN cause a partial defect in gliding. A novel bacteriophage selection strategy was used to aid construction of a strain with a deletion spanning gldN and the closely related gene gldO in an otherwise wild-type F. johnsoniae UW101 background. Bacteriophage transduction was used to move a gldN mutation into F. johnsoniae UW101 to allow phenotypic comparison with the gldNO deletion mutant. Cells of the gldN mutant formed nonspreading colonies on agar but retained some ability to glide in wet mounts. In contrast, cells of the gldNO deletion mutant were completely nonmotile, indicating that cells require GldN, or the GldN-like protein GldO, to glide. Recent results suggest that Porphyromonas gingivalis PorN, which is similar in sequence to GldN, has a role in protein secretion across the outer membrane. Cells of the F. johnsoniae gldNO deletion mutant were defective in localization of the motility protein SprB to the cell surface, suggesting that GldN may be involved in secretion of components of the motility machinery. Cells of the gldNO deletion mutant were also deficient in chitin utilization and were resistant to infection by bacteriophages, phenotypes that may also be related to defects in protein secretion.

post to: CiteULike

Proteolytic regulation of toxin-antitoxin systems by ClpPC in Staphylococcus aureus.

Publication Date: 2010 Mar PMID: 20038589
Authors: Donegan, N. P. - Thompson, E. T. - Fu, Z. - Cheung, A. L.
Journal: J Bacteriol

Bacterial toxin-antitoxin (TA) systems typically consist of a small, labile antitoxin that inactivates a specific longer-lived toxin. In Escherichia coli, such antitoxins are proteolytically regulated by the ATP-dependent proteases Lon and ClpP. Under normal conditions, antitoxin synthesis is sufficient to replace this loss from proteolysis, and the bacterium remains protected from the toxin. However, if TA production is interrupted, antitoxin levels decrease, and the cognate toxin is free to inhibit the specific cellular component, such as mRNA, DnaB, or gyrase. To date, antitoxin degradation has been studied only in E. coli, so it remains unclear whether similar mechanisms of regulation exist in other organisms. To address this, we followed antitoxin levels over time for the three known TA systems of the major human pathogen Staphylococcus aureus, mazEF, axe1-txe1, and axe2-txe2. We observed that the antitoxins of these systems, MazE(sa), Axe1, and Axe2, respectively, were all degraded rapidly (half-life [t(1/2)], approximately 18 min) at rates notably higher than those of their E. coli counterparts, such as MazE (t(1/2), approximately 30 to 60 min). Furthermore, when S. aureus strains deficient for various proteolytic systems were examined for changes in the half-lives of these antitoxins, only strains with clpC or clpP deletions showed increased stability of the molecules. From these studies, we concluded that ClpPC serves as the functional unit for the degradation of all known antitoxins in S. aureus.

post to: CiteULike

ClpP of Streptococcus mutans differentially regulates expression of genomic islands, mutacin production, and antibiotic tolerance.

Publication Date: 2010 Mar PMID: 20038588
Authors: Chattoraj, P. - Banerjee, A. - Biswas, S. - Biswas, I.
Journal: J Bacteriol

Streptococcus mutans is the primary etiological agent of human dental caries and, at times, of infective endocarditis. Within the oral cavity, the pathogen is subjected to conditions of stress. A well-conserved protein complex named ClpP (caseinolytic protease) plays a vital role in adaptation under stress conditions. To gain a better understanding of the global role of the ClpP protease in cellular homeostasis, a transcriptome analysis was performed using a DeltaclpP mutant strain. The expression levels of more than 100 genes were up- or downregulated in the DeltaclpP mutant compared to the wild type. Notably, the expression of genes in several genomic islands, such as TnSmu1 and TnSmu2, was differentially modulated in the DeltaclpP mutant strain. ClpP deficiency also increased the expression of genes associated with a putative CRISPR locus. Furthermore, several stress-related genes and genes encoding bacteriocin-related peptides and many transcription factors were also found to be altered in the DeltaclpP mutant strain. A comparative analysis of the two-dimensional protein profile of the wild type and the DeltaclpP mutant strains showed altered protein profiles. Comparison of the transcriptome data with the proteomic data identified four common gene products, suggesting that the observed altered protein expression of these genes could be due to altered transcription. The results presented here indicate that ClpP-mediated proteolysis plays an important global role in the regulation of several important traits in this pathogen.

post to: CiteULike

Roles of RubisCO and the RubisCO-like protein in 5-methylthioadenosine metabolism in the Nonsulfur purple bacterium Rhodospirillum rubrum.

Publication Date: 2010 Mar PMID: 20038587
Authors: Singh, J. - Tabita, F. R.
Journal: J Bacteriol

Ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) catalyzes the assimilation of atmospheric CO(2) into organic matter and is thus central to the existence of life on earth. The beginning of the 2000s was marked by the discovery of a new family of proteins, the RubisCO-like proteins (RLPs), which are structural homologs of RubisCO. RLPs are unable to catalyze CO(2) fixation. The RLPs from Chlorobaculum tepidum, Bacillus subtilis, Geobacillus kaustophilus, and Microcystis aeruginosa have been shown to participate in sulfur metabolism. Whereas the precise function of C. tepidum RLP is unknown, the B. subtilis, G. kaustophilus, and M. aeruginosa RLPs function as tautomerases/enolases in a methionine salvage pathway (MSP). Here, we show that the form II RubisCO enzyme from the nonsulfur purple bacterium Rhodospirillum rubrum is also able to function as an enolase in vivo as part of an MSP, but only under anaerobic conditions. However, unlike B. subtilis RLP, R. rubrum RLP does not catalyze the enolization of 2,3-diketo-5-methylthiopentyl-1-phosphate. Instead, under aerobic growth conditions, R. rubrum RLP employs another intermediate of the MSP, 5-methylthioribulose-1-phosphate, as a substrate, resulting in the formation of different products. To further determine the interrelationship between RubisCOs and RLPs (and the potential integration of cellular carbon and sulfur metabolism), the functional roles of both RubisCO and RLP have been examined in vivo via the use of specific knockout strains and complementation studies of R. rubrum. The presence of functional, yet separate, MSPs in R. rubrum under both aerobic (chemoheterotrophic) and anaerobic (photoheterotrophic) growth conditions has not been observed previously in any organism. Moreover, the aerobic and anaerobic sulfur salvage pathways appear to be differentially controlled, with novel and previously undescribed steps apparent for sulfur salvage in this organism.

post to: CiteULike

Coproporphyrin excretion and low thiol levels caused by point mutation in the Rhodobacter sphaeroides S-adenosylmethionine synthetase gene.

Publication Date: 2010 Mar PMID: 20038586
Authors: Sabaty, M. - Adryanczyk, G. - Roustan, C. - Cuine, S. - Lamouroux, C. - Pignol, D.
Journal: J Bacteriol

A spontaneous mutant of Rhodobacter sphaeroides f. sp. denitrificans IL-106 was found to excrete a large amount of a red compound identified as coproporphyrin III, an intermediate in bacteriochlorophyll and heme synthesis. The mutant, named PORF, is able to grow under phototrophic conditions but has low levels of intracellular cysteine and glutathione and overexpresses the cysteine synthase CysK. The expression of molybdoenzymes such as dimethyl sulfoxide (DMSO) and nitrate reductases is also affected under certain growth conditions. Excretion of coproporphyrin and overexpression of CysK are not directly related but were both found to be consequences of a diminished synthesis of the key metabolite S-adenosylmethionine (SAM). The wild-type phenotype is restored when the gene metK encoding SAM synthetase is supplied in trans. The metK gene in the mutant strain has a mutation leading to a single amino acid change (H145Y) in the encoded protein. This point mutation is responsible for a 70% decrease in intracellular SAM content which probably affects the activities of numerous SAM-dependent enzymes such as coproporphyrinogen oxidase (HemN); uroporphyrinogen III methyltransferase (CobA), which is involved in siroheme synthesis; and molybdenum cofactor biosynthesis protein A (MoaA). We propose a model showing that the attenuation of the activities of SAM-dependent enzymes in the mutant could be responsible for the coproporphyrin excretion, the low cysteine and glutathione contents, and the decrease in DMSO and nitrate reductase activities.

post to: CiteULike

MreB drives de novo rod morphogenesis in Caulobacter crescentus via remodeling of the cell wall.

Publication Date: 2010 Mar PMID: 20023035
Authors: Takacs, C. N. - Poggio, S. - Charbon, G. - Pucheault, M. - Vollmer, W. - Jacobs-Wagner, C.
Journal: J Bacteriol

MreB, the bacterial actin-like cytoskeleton, is required for the rod morphology of many bacterial species. Disruption of MreB function results in loss of rod morphology and cell rounding. Here, we show that the widely used MreB inhibitor A22 causes MreB-independent growth inhibition that varies with the drug concentration, culture medium conditions, and bacterial species tested. MP265, an A22 structural analog, is less toxic than A22 for growth yet equally efficient for disrupting the MreB cytoskeleton. The action of A22 and MP265 is enhanced by basic pH of the culture medium. Using this knowledge and the rapid reversibility of drug action, we examined the restoration of rod shape in lemon-shaped Caulobacter crescentus cells pretreated with MP265 or A22 under nontoxic conditions. We found that reversible restoration of MreB function after drug removal causes extensive morphological changes including a remarkable cell thinning accompanied with elongation, cell branching, and shedding of outer membrane vesicles. We also thoroughly characterized the composition of C. crescentus peptidoglycan by high-performance liquid chromatography and mass spectrometry and showed that MreB disruption and recovery of rod shape following restoration of MreB function are accompanied by considerable changes in composition. Our results provide insight into MreB function in peptidoglycan remodeling and rod shape morphogenesis and suggest that MreB promotes the transglycosylase activity of penicillin-binding proteins.

post to: CiteULike

Characterization of CamH from Methanosarcina thermophila, founding member of a subclass of the {gamma} class of carbonic anhydrases.

Publication Date: 2010 Mar PMID: 20023030
Authors: Zimmerman, S. A. - Tomb, J. F. - Ferry, J. G.
Journal: J Bacteriol

The homotrimeric enzyme Mt-Cam from Methanosarcina thermophila is the archetype of the gamma class of carbonic anhydrases. A search of databases queried with Mt-Cam revealed that a majority of the homologs comprise a putative subclass (CamH) in which there is major conservation of all of the residues essential for the archetype Mt-Cam except Glu62 and an acidic loop containing the essential proton shuttle residue Glu84. The CamH homolog from M. thermophila (Mt-CamH) was overproduced in Escherichia coli and characterized to validate its activity and initiate an investigation of the CamH subclass. The Mt-CamH homotrimer purified from E. coli cultured with supplemental zinc (Zn-Mt-CamH) contained 0.71 zinc and 0.15 iron per monomer and had k(cat) and k(cat)/K(m) values that were substantially lower than those for the zinc form of Mt-Cam (Zn-Mt-Cam). Mt-CamH purified from E. coli cultured with supplemental iron (Fe-Mt-CamH) was also a trimer containing 0.15 iron per monomer and only a trace amount of zinc and had an effective k(cat) (k(cat)(eff)) value normalized for iron that was 6-fold less than that for the iron form of Mt-Cam, whereas the k(cat)/K(m)(eff) was similar to that for Fe-Mt-Cam. Addition of 50 mM imidazole to the assay buffer increased the k(cat)(eff) of Fe-Mt-CamH more than 4-fold. Fe-Mt-CamH lost activity when it was exposed to air or 3% H(2)O(2), which supports the hypothesis that Fe(2+) has a role in the active site. The k(cat) for Fe-Mt-CamH was dependent on the concentration of buffer in a way that indicates that it acts as a second substrate in a "ping-pong" mechanism accepting a proton. The k(cat)/K(m) was not dependent on the buffer, consistent with the mechanism for all carbonic anhydrases in which the interconversion of CO(2) and HCO(3)(-) is separate from intermolecular proton transfer.

post to: CiteULike

Manipulating each MreB of Bdellovibrio bacteriovorus gives diverse morphological and predatory phenotypes.

Publication Date: 2010 Mar PMID: 20023029
Authors: Fenton, A. K. - Lambert, C. - Wagstaff, P. C. - Sockett, R. E.
Journal: J Bacteriol

We studied the two mreB genes, encoding actinlike cytoskeletal elements, in the predatory bacterium Bdellovibrio bacteriovorus. This bacterium enters and replicates within other Gram-negative bacteria by attack-phase Bdellovibrio squeezing through prey outer membrane, residing and growing filamentously in the prey periplasm forming an infective "bdelloplast," and septating after 4 h, once the prey contents are consumed. This lifestyle brings challenges to the Bdellovibrio cytoskeleton. Both mreB genes were essential for viable predatory growth, but C-terminal green fluorescent protein tagging each separately with monomeric teal-fluorescent protein (mTFP) gave two strains with phenotypic changes at different stages in predatory growth and development. MreB1-mTFP cells arrested growth early in bdelloplast formation, despite successful degradation of prey nucleoid. A large population of stalled bdelloplasts formed in predatory cultures and predation proceeded very slowly. A small proportion of bdelloplasts lysed after several days, liberating MreB1-mTFP attack-phase cells of wild-type morphology; this process was aided by subinhibitory concentrations of an MreB-specific inhibitor, A22. MreB2-mTFP, in contrast, was predatory at an almost wild-type rate but yielded attack-phase cells with diverse morphologies, including spherical, elongated, and branched, the first time such phenotypes have been described. Wild-type predatory rates were seen for all but spherical morphotypes, and septation of elongated morphotypes was achieved by the addition of A22.

post to: CiteULike

Escherichia coli RNase R has dual activities, helicase and RNase.

Publication Date: 2010 Mar PMID: 20023028
Authors: Awano, N. - Rajagopal, V. - Arbing, M. - Patel, S. - Hunt, J. - Inouye, M. - Phadtare, S.
Journal: J Bacteriol

In Escherichia coli, the cold shock response occurs when there is a temperature downshift from 37 degrees C to 15 degrees C, and this response is characterized by induction of several cold shock proteins, including the DEAD-box helicase CsdA, during the acclimation phase. CsdA is involved in a variety of cellular processes. Our previous studies showed that the helicase activity of CsdA is critical for its function in cold shock acclimation of cells and that the only proteins that were able to complement its function were another helicase, RhlE, an RNA chaperone, CspA, and a cold-inducible exoribonuclease, RNase R. Interestingly, other major 3'-to-5' processing exoribonucleases of E. coli, such as polynucleotide phosphorylase and RNase II, cannot complement the cold shock function of CsdA. Here we carried out a domain analysis of RNase R and showed that this protein has two distinct activities, RNase and helicase, which are independent of each other and are due to different domains. Mutant RNase R proteins that lack the RNase activity but exhibit the helicase activity were able to complement the cold shock function of CsdA, suggesting that only the helicase activity of RNase R is essential for complementation of the cold shock function of CsdA. We also observed that in vivo deletion of the two cold shock domains resulted in a loss of the ability of RNase R to complement the cold shock function of CsdA. We further demonstrated that RNase R exhibits helicase activity in vitro independent of its RNase activity. Our results shed light on the unique properties of RNase R and how it is distinct from other exoribonucleases in E. coli.

post to: CiteULike

Plasmid segregation: birds of a feather try not to flock together.

Publication Date: 2010 Mar PMID: 20023023
Authors: Anand, S. P. - Khan, S. A.
Journal: J Bacteriol

post to: CiteULike

Purification of Helicobacter pylori NCTC 11637 cytochrome bc1 and respiration with D-proline as a substrate.

Publication Date: 2010 Mar PMID: 20023020
Authors: Tanigawa, M. - Shinohara, T. - Nishimura, K. - Nagata, K. - Ishizuka, M. - Nagata, Y.
Journal: J Bacteriol

Helicobacter pylori is a microaerophilic bacterium associated with gastric inflammation and peptic ulcers. Knowledge of how pathogenic organisms produce energy is important from a therapeutic point of view. We found d-amino acid dehydrogenase-mediated electron transport from d-proline or d-alanine to oxygen via the respiratory chain in H. pylori. Coupling of the electron transport to ATP synthesis was confirmed by using uncoupler reagents. We reconstituted the electron transport chain to demonstrate the electron flow from the d-amino acids to oxygen using the recombinant cytochrome bc(1) complex, cytochrome c-553, and the terminal oxidase cytochrome cbb(3) complex. Upon addition of the recombinant d-amino acid dehydrogenase and d-proline or d-alanine to the reconstituted electron transport system, reduction of cytochrome cbb(3) and oxygen consumption was revealed spectrophotometrically and polarographically, respectively. Among the constituents of H. pylori's electron transport chain, only the cytochrome bc(1) complex had been remained unpurified. Therefore, we cloned and sequenced the H. pylori NCTC 11637 cytochrome bc(1) gene clusters encoding Rieske Fe-S protein, cytochrome b, and cytochrome c(1), with calculated molecular masses of 18 kDa, 47 kDa, and 32 kDa, respectively, and purified the recombinant monomeric protein complex with a molecular mass of 110 kDa by gel filtration. The absorption spectrum of the recombinant cytochrome bc(1) complex showed an alpha peak at 561 nm with a shoulder at 552 nm.

post to: CiteULike

The Mycobacterium tuberculosis DosR regulon assists in metabolic homeostasis and enables rapid recovery from nonrespiring dormancy.

Publication Date: 2010 Mar PMID: 20023019
Authors: Leistikow, R. L. - Morton, R. A. - Bartek, I. L. - Frimpong, I. - Wagner, K. - Voskuil, M. I.
Journal: J Bacteriol

Mycobacterium tuberculosis survives in latently infected individuals, likely in a nonreplicating or dormancy-like state. The M. tuberculosis DosR regulon is a genetic program induced by conditions that inhibit aerobic respiration and prevent bacillus replication. In this study, we used a mutant incapable of DosR regulon induction to investigate the contribution of this regulon to bacterial metabolism during anaerobic dormancy. Our results confirm that the DosR regulon is essential for M. tuberculosis survival during anaerobic dormancy and demonstrate that it is required for metabolic processes that occur upon entry into and throughout the dormant state. Specifically, we showed that regulon mechanisms shift metabolism away from aerobic respiration in the face of dwindling oxygen availability and are required for maintaining energy levels and redox balance as the culture becomes anaerobic. We also demonstrated that the DosR regulon is crucial for rapid resumption of growth once M. tuberculosis exits an anaerobic or nitric oxide-induced nonrespiring state. In summary, the DosR regulon encodes novel metabolic mechanisms essential for M. tuberculosis to survive in the absence of respiration and to successfully transition rapidly between respiring and nonrespiring conditions without loss of viability.

post to: CiteULike

Evidence for rare capsular switching in Streptococcus agalactiae.

Publication Date: 2010 Mar PMID: 20023016
Authors: Martins, E. R. - Melo-Cristino, J. - Ramirez, M.
Journal: J Bacteriol

The polysaccharide capsule is a major antigenic factor in Streptococcus agalactiae (Lancefield group B streptococcus [GBS]). Previous observations suggest that exchange of capsular loci is likely to occur rather frequently in GBS, even though GBS is not known to be naturally transformable. We sought to identify and characterize putative capsular switching events, by means of a combination of phenotypic and genotypic methods, including pulsed-field gel electrophoretic profiling, multilocus sequence typing, and surface protein and pilus gene profiling. We show that capsular switching by horizontal gene transfer is not as frequent as previously suggested. Serotyping errors may be the main reason behind the overestimation of capsule switching, since phenotypic techniques are prone to errors of interpretation. The identified putative capsular transformants involved the acquisition of the entire capsular locus and were not restricted to the serotype-specific central genes, the previously suggested main mechanism underlying capsular switching. Our data, while questioning the frequency of capsular switching, provide clear evidence for in vivo capsular transformation in S. agalactiae, which may be of critical importance in planning future vaccination strategies against this pathogen.

post to: CiteULike

Genome-wide identification of targets for the archaeal heat shock regulator phr by cell-free transcription of genomic DNA.

Publication Date: 2010 Mar PMID: 20023014
Authors: Keese, A. M. - Schut, G. J. - Ouhammouch, M. - Adams, M. W. - Thomm, M.
Journal: J Bacteriol

The hyperthermophilic archaeon Pyrococcus furiosus grows optimally near 100 degrees C and undergoes a heat shock response at 105 degrees C, mediated at least in part by the heat shock regulator Phr. Genes encoding a small heat shock protein (HSP20) and a member of the AAA(+) ATPase are the only known targets of the regulator, but a genetic mutant of Phr has yet to be characterized. We describe here an alternative approach for the identification of the regulon of Phr based on cell-free transcription of fragmented chromosomal DNA in the presence or absence of the regulator and hybridization of in vitro RNA to P. furiosus whole-genome microarrays. Our results confirmed the phr, the hsp20, and the aaa(+) ATPase genes as targets of Phr and also identified six additional open reading frames, PF0624, PF1042, PF1291, PF1292, PF1488, and PF1616, as Phr-responsive genes, which include that encoding di-myo-inositol phosphate synthase. Transcription of the identified novel genes was inhibited by Phr in standard transcription assays, and the novel consensus sequence 5'-TTTAnnnACnnnnnGTnAnnAAAA-3' (uppercase letters denote a high conservation of the bases) was inferred from our data as the Phr recognition motif. Mutational evidence for the significance of this sequence as Phr recognition was provided in DNA-binding experiments.

post to: CiteULike

Nitrogenase switch-off and regulation of ammonium assimilation in response to light deprivation in Rhodospirillum rubrum are influenced by the nitrogen source used during growth.

Publication Date: 2010 Mar PMID: 20023013
Authors: Teixeira, P. F. - Wang, H. - Nordlund, S.
Journal: J Bacteriol

Nitrogen fixation and ammonium assimilation in Rhodospirillum rubrum are regulated in response to changes in light availability, and we show that the response in terms of glutamine synthetase activity and P(II) modification is dependent on the nitrogen source used for growth, N(2) or glutamate, although both lead to nitrogenase derepression.

post to: CiteULike

Completed genome sequence of the anaerobic iron-oxidizing bacterium Acidovorax ebreus strain TPSY.

Publication Date: 2010 Mar PMID: 20023012
Authors: Byrne-Bailey, K. G. - Weber, K. A. - Chair, A. H. - Bose, S. - Knox, T. - Spanbauer, T. L. - Chertkov, O. - Coates, J. D.
Journal: J Bacteriol

Acidovorax ebreus strain TPSY is the first anaerobic nitrate-dependent Fe(II) oxidizer for which there is a completed genome sequence. Preliminary protein annotation revealed an organism optimized for survival in a complex environmental system. Here, we briefly report the completed and annotated genome sequence of strain TPSY.

post to: CiteULike

Glycine betaine biosynthesized from glycine provides an osmolyte for cell growth and spore germination during osmotic stress in Myxococcus xanthus.

Publication Date: 2010 Mar PMID: 20023011
Authors: Kimura, Y. - Kawasaki, S. - Yoshimoto, H. - Takegawa, K.
Journal: J Bacteriol

Glycine sarcosine methyltransferase (Gsm) and sarcosine dimethylglycine methyltransferase (Sdm) catalyze glycine betaine synthesis from glycine. Disruption of the M. xanthus gsmA (MXAN 7068) or sdmA (MXAN 3190) gene, encoding Gsm or Sdm homologue proteins, respectively, generated mutants that exhibited a longer lag period of growth and delayed spore germination under osmostress.

post to: CiteULike

A novel pheromone quorum-sensing system controls the development of natural competence in Streptococcus thermophilus and Streptococcus salivarius.

Publication Date: 2010 Mar PMID: 20023010
Authors: Fontaine, L. - Boutry, C. - de Frahan, M. H. - Delplace, B. - Fremaux, C. - Horvath, P. - Boyaval, P. - Hols, P.
Journal: J Bacteriol

In streptococcal species, the key step of competence development is the transcriptional induction of comX, which encodes the alternative sigma factor sigma(X), which positively regulates genes necessary for DNA transformation. In Streptococcus species belonging to the mitis and mutans groups, induction of comX relies on the activation of a three-component system consisting of a secreted pheromone, a histidine kinase, and a response regulator. In Streptococcus thermophilus, a species belonging to the salivarius group, the oligopeptide transporter Ami is essential for comX expression under competence-inducing conditions. This suggests a different regulation pathway of competence based on the production and reimportation of a signal peptide. The objective of our work was to identify the main actors involved in the early steps of comX induction in S. thermophilus LMD-9. Using a transcriptomic approach, four highly induced early competence operons were identified. Among them, we found a Rgg-like regulator (Ster_0316) associated with a nonannotated gene encoding a 24-amino-acid hydrophobic peptide (Shp0316). Through genetic deletions, we showed that these two genes are essential for comX induction. Moreover, addition to the medium of synthetic peptides derived from the C-terminal part of Shp0316 restored comX induction and transformation of a Shp0316-deficient strain. These peptides also induced competence in S. thermophilus and Streptococcus salivarius strains that are poorly transformable or not transformable. Altogether, our results show that Ster_0316 and Shp0316, renamed ComRS, are the two members of a novel quorum-sensing system responsible for comX induction in species from the salivarius group, which differs from the classical phosphorelay three-component system identified previously in streptococci.

post to: CiteULike

Functional analysis of the stability determinant AlfB of pBET131, a miniplasmid derivative of bacillus subtilis (natto) plasmid pLS32.

Publication Date: 2010 Mar PMID: 20023009
Authors: Tanaka, T.
Journal: J Bacteriol

Bacillus subtilis plasmid pBET131 is a derivative of pLS32, which was isolated from a natto strain of Bacillus subtilis. The DNA region in pBET131 that confers segregational stability contains an operon consisting of three genes, of which alfA, encoding an actin-like ATPase, and alfB are essential for plasmid stability. In this work, the alfB gene product and its target DNA region were studied in detail. Transcription of the alf operon initiated from a sigma(A)-type promoter was repressed by the alfB gene product. Overproduction of AlfA was inhibitory to cell growth, suggesting that the repression of the alf operon by AlfB is important for maintaining appropriate levels of AlfA. An electrophoretic mobility shift assay and footprinting analysis with purified His-tagged AlfB showed that it bound to a DNA region containing three tandem repeats of 8-bp AT-rich sequence (here designated parN), which partially overlaps the -35 sequence of the promoter. A sequence alteration in the first or third repeat did not affect the AlfB binding and plasmid stability, whereas that in the second repeat resulted in inhibition of these phenomena. The repression of alfA-lacZ expression was observed in the constructs carrying a mutation in either the first or third repeat, but not in the second repeat, indicating a correlation between plasmid stability, AlfB binding, and repression. It was also demonstrated by the yeast two-hybrid system that AlfA and AlfB interact with each other and among themselves. From these results, it was concluded that AlfB participates in partitioning pBET131 by forming a complex with AlfA and parN, the mode of which is typified by the type II partition mechanism.

post to: CiteULike

ExsD inhibits expression of the Pseudomonas aeruginosa type III secretion system by disrupting ExsA self-association and DNA binding activity.

Publication Date: 2010 Mar PMID: 20008065
Authors: Brutinel, E. D. - Vakulskas, C. A. - Yahr, T. L.
Journal: J Bacteriol

Pseudomonas aeruginosa utilizes a type III secretion system (T3SS) to damage eukaryotic host cells and evade phagocytosis. Transcription of the T3SS regulon is controlled by ExsA, a member of the AraC/XylS family of transcriptional regulators. ExsA-dependent transcription is coupled to type III secretory activity through a cascade of three interacting proteins (ExsC, ExsD, and ExsE). Genetic data suggest that ExsD functions as an antiactivator by preventing ExsA-dependent transcription, ExsC functions as an anti-antiactivator by binding to and inhibiting ExsD, and ExsE binds to and inhibits ExsC. T3SS gene expression is activated in response to low-calcium growth conditions or contact with host cells, both of which trigger secretion of ExsE. In the present study we reconstitute the T3SS regulatory cascade in vitro using purified components and find that the ExsD.ExsA complex lacks DNA binding activity. As predicted by the genetic data, ExsC addition dissociates the ExsD.ExsA complex through formation of an ExsD.ExsC complex, thereby releasing ExsA to bind T3SS promoters and activate transcription. Addition of ExsE to the purified system results in formation of the ExsE.ExsC complex and prevents ExsC from dissociating the ExsD.ExsA complex. Although purified ExsA is monomeric in solution, bacterial two-hybrid analyses demonstrate that ExsA can self-associate and that ExsD inhibits self-association of ExsA. Based on these data we propose a model in which ExsD regulates ExsA-dependent transcription by inhibiting the DNA-binding and self-association properties of ExsA.

post to: CiteULike

Genome-wide characterization of the SloR metalloregulome in Streptococcus mutans.

Publication Date: 2010 Mar PMID: 19915021
Authors: O'Rourke, K. P. - Shaw, J. D. - Pesesky, M. W. - Cook, B. T. - Roberts, S. M. - Bond, J. P. - Spatafora, G. A.
Journal: J Bacteriol

Streptococcus mutans is the primary causative agent of human dental caries, a ubiquitous infectious disease for which effective treatment strategies remain elusive. We investigated a 25-kDa SloR metalloregulatory protein in this oral pathogen, along with its target genes that contribute to cariogenesis. Previous studies have demonstrated manganese- and SloR-dependent repression of the sloABCR metal ion transport operon in S. mutans. In the present study, we demonstrate that S. mutans coordinates this repression with that of certain virulence attributes. Specifically, we noted virulence gene repression in a manganese-containing medium when SloR binds to promoter-proximal sequence palindromes on the S. mutans chromosome. We applied a genome-wide approach to elucidate the sequences to which SloR binds and to reveal additional "class I" genes that are subject to SloR- and manganese-dependent repression. These analyses identified 204 S. mutans genes that are preceded by one or more conserved palindromic SloR recognition elements (SREs). We cross-referenced these genes with those that we had identified previously as SloR and/or manganese modulated in microarray and real-time quantitative reverse transcription-PCR (qRT-PCR) experiments. From this analysis, we identified a number of S. mutans virulence genes that are subject to transcriptional upregulation by SloR and noted that such "class II"-type regulation is dependent on direct SloR binding to promoter-distal SREs. These observations are consistent with a bifunctional role for the SloR metalloregulator and implicate it as a target for the development of therapies aimed at alleviating S. mutans-induced caries formation.

post to: CiteULike

P1 plasmid segregation: accurate redistribution by dynamic plasmid pairing and separation.

Publication Date: 2010 Mar PMID: 19897644
Authors: Sengupta, M. - Nielsen, H. J. - Youngren, B. - Austin, S.
Journal: J Bacteriol

Low-copy-number plasmids, such as P1 and F, encode a type Ia partition system (P1par or Fsop) for active segregation of copies to daughter cells. Typical descriptions show a single central plasmid focus dividing and the products moving to the cell quarter regions, ensuring segregation. However, using improved optical and analytical tools and large cell populations, we show that P1 plasmid foci are very broadly distributed. Moreover, under most growth conditions, more than two foci are frequently present. Each focus contains either one or two plasmid copies. Replication and focus splitting occur at almost any position in the cell. The products then move rapidly apart for approximately 40% of the cell length. They then tend to maintain their relative positions. The segregating foci often pass close to or come to rest close to other foci in the cell. Foci frequently appear to fuse during these encounters. Such events occur several times in each cell and cell generation on average. We argue that foci pair with their neighbors and then actively separate again. The net result is an approximately even distribution of foci along the long cell axis on average. We show mathematically that trans-pairing and active separation could greatly increase the accuracy of segregation and would produce the distributions of foci that we observe. Plasmid pairing and separation may constitute a novel fine-tuning mechanism that takes the basic pattern created when plasmids separate after replication and converts it to a roughly even pattern that greatly improves the fidelity of plasmid segregation.

post to: CiteULike